Question

General Biology 2 Module 1 (Genetics) CN: Name: __________________________________ Group No: _ Score: _ /20 Grade and Section: _ Date: Teacher: _ ACTIVITY 1.4 PEDIGREE ANALYSIS AND PROTEIN SYNTHESIS In humans, albinism is a recessive trait. The disorder causes a lack of pigment in the skin and hair, making an albino appear very pale with white hair and pale blue eyes. This disorder also occurs in animals, a common albino found in a laboratory is the white rat. The pedigrees below trace the inheritance of the allele that causes albinism. In each pedigree, a male is represented by a square and a female is represented by a circle. If the shape is shaded, that indicates that the individual displays the trait being studied. In the case below, shaded circles represent individuals who are albino (aa). 1. Given the following genotypes, describe the phenotypes (normal or albino) AA = _ Aa = _ aa = _____________ Fill in the blanks on the pedigree on the right. How many children does this family have? _ What are the sexes of the children? __ 2. Fill out the blanks of the pedigree: (AA, Aa, or aa) How many children did the original couple have? How many grandchildren do they have? 3. You are a Geneticist working in a laboratory when a doctor came and handed you an extracted human insulin. You were able to decode the DNA sequence of the sample and so below is a section of the human insulin sequence located in Row A. In Row B, give the complimentary base pair of the sequence and transcribe the DNA strand into mRNA in Row C, then, translate that strand into a polypeptide chain, identifying the codons in Row D, the anti-codons in Row E and the amino acid sequence in Row F. Use the Translation table provided as your reference. Don't forget to give the directionality of all the sequence. (10 pts) A 5' GCGTATAATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTA 3'

General Biology 2 Module 1 (Genetics)

CN: ______ Name: ________________________________________________ Group No: ___________ Score: _____ /20
Grade and Section: _______________ Date: ________________ Teacher: _______________________________

ACTIVITY 1.4
PEDIGREE ANALYSIS AND PROTEIN SYNTHESIS

In humans, albinism is a recessive trait. The disorder causes a lack of pigment in the skin and hair, making an albino appear very pale with white hair and pale blue eyes. This disorder also occurs in animals, a common albino found in a laboratory is the white rat. The pedigrees below trace the inheritance of the allele that causes albinism. In each pedigree, a male is represented by a square and a female is represented by a circle. If the shape is shaded, that indicates that the individual displays the trait being studied. In the case below, shaded circles represent individuals who are albino (aa).

1. Given the following genotypes, describe the phenotypes (normal or albino)
AA = ___________________________________
Aa = ___________________________________
aa = ___________________________________
Fill in the blanks on the pedigree on the right.

How many children does this family have? _________
What are the sexes of the children? __________

2. Fill out the blanks of the pedigree: (AA, Aa, or aa)
How many children did the original couple have? ____
How many grandchildren do they have? ____

3. You are a Geneticist working in a laboratory when a doctor came and handed you an extracted human insulin. You were able to decode the DNA sequence of the sample and so below is a section of the human insulin sequence located in Row A. In Row B, give the complimentary base pair of the sequence and transcribe the DNA strand into mRNA in Row C, then, translate that strand into a polypeptide chain, identifying the codons in Row D, the anti-codons in Row E and the amino acid sequence in Row F. Use the Translation table provided as your reference. Don't forget to give the directionality of all the sequence. (10 pts)

A 5' GCGTATAATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTA 3'

General Biology 2 Module 1 (Genetics)

CN: Name: Group No: Score: /20
Grade and Section: Date: Teacher:

ACTIVITY 1.4
PEDIGREE ANALYSIS AND PROTEIN SYNTHESIS

In humans, albinism is a recessive trait. The disorder causes a lack of pigment in the skin and hair, making an albino appear very pale with white hair and pale blue eyes. This disorder also occurs in animals, a common albino found in a laboratory is the white rat. The pedigrees below trace the inheritance of the allele that causes albinism. In each pedigree, a male is represented by a square and a female is represented by a circle. If the shape is shaded, that indicates that the individual displays the trait being studied. In the case below, shaded circles represent individuals who are albino (aa).

1. Given the following genotypes, describe the phenotypes (normal or albino)
AA =
Aa =
aa =
Fill in the blanks on the pedigree on the right.

How many children does this family have?
What are the sexes of the children?

2. Fill out the blanks of the pedigree: (AA, Aa, or aa)
How many children did the original couple have?
How many grandchildren do they have?

3. You are a Geneticist working in a laboratory when a doctor came and handed you an extracted human insulin. You were able to decode the DNA sequence of the sample and so below is a section of the human insulin sequence located in Row A. In Row B, give the complimentary base pair of the sequence and transcribe the DNA strand into mRNA in Row C, then, translate that strand into a polypeptide chain, identifying the codons in Row D, the anti-codons in Row E and the amino acid sequence in Row F. Use the Translation table provided as your reference. Don't forget to give the directionality of all the sequence. (10 pts)

A 5' GCGTATAATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTA 3'

Added by Emily P.

Question

Please give Ace some feedback