3' 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 5' G T T A C T T T G C G G A A A T T G A C T C A A T G A A A C G C C T T T A A C T G A mRNA: G U U A C U U U G C G G A A A U U G A C U polypeptide Gln-STOP-Asn-Ala-Phe-Asn-STOP 2. In the wt DNA strand shown in the previous problem, what would be the effect on the resulting polypeptide if T is mutated to A at base 6? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = GTT ACA TTG CGG AAA TTG ACT mRNA = CAA UGU AAC GCC UUU AAC UGA Polypeptide = GLN-CYS-ASN-ALA-PHE-ASN-STOP 3. What would be the effect on the polypeptide if T is mutated to C at base 17 on the wt DNA? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = 3' GTTACTTTGCGGAAATCGACT 5' mRNA = 5' CAA UGA AACCCC UUVA GOUGA 3' Polypeptide = gln-stop-asn-ala-phe-ser-stop 4. What would be the effect on the polypeptide of deleting base 7 on the wt DNA? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = 3' GTTACTTGCGGAAATTGACT 5' mRNA = 5' CAAUGAACGCCUUAACUGA 3' Polypeptide = Gln-Stop-Thr-Pro-Leu-Thr 5. What are the names of these types of base substitutions or addition/deletion mutations? Mutation in A Mutation in B Mutation in C
Added by Joseph D.
Close
Step 1
Mutation at base 6 (T to A): Original DNA: GTT ACT TTG CGG AAA TTG ACT Mutated DNA: GTT ACA TTG CGG AAA TTG ACT Original mRNA: CAA UGA AAC GCC UUU AAC UGA Mutated mRNA: CAA UGU AAC GCC UUU AAC UGA Original Polypeptide: Gln-Stop-Asn-Ala-Phe-Asn-Stop Mutated Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 90 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
10. Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? 11. This would be an example of which type of a point mutation? 12. Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? 13. This would be an example of which type of a point mutation? 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? 15. This would be an example of which type of a point mutation?
Nicole C.
Let's say that a mutation occurred in in a stretch of DNA. The mutation has resulted in the following mRNA sequence that has a single nucleotide change (in bold and underline). Unmutated DNA - A G A A U G G A C A G A A A C U U U U G A Mutated DNA - A G A A U G G A C U G A A A C U U U U G A What type of mutation is this (missense, nonsense, silent, or frameshift)?
Adi S.
A mutation in the mRNA for the protein chymotrypsin results in a codon sequence of 5'-UAU-3' (instead of 3'-UAC-5'). Which of the following aberrations in protein synthesis might this mutation cause? Middle Letter First Letter U Reading frame 5' 3' UUU Phenylalanine UUC Phenylalanine UUA Leucine UUG Leucine C Reading frame 5' 3' UCU Serine UCC Serine UCA Serine UCG Serine A Reading frame 5' 3' UAU Tyrosine UAC Tyrosine UAA (Stop) UAG (Stop) G Reading frame 5' 3' UGU Cysteine UGC Cysteine UGA (Stop) UGG Tryptophan Last Letter U C A G C CUU Leucine CUC Leucine CUA Leucine CUG Leucine CCU Proline CCC Proline CCA Proline CCG Proline CAU Histidine CAC Histidine CAA Glutamine CAG Glutamine CGU Arginine CGC Arginine CGA Arginine CGG Arginine U C A G A AUU Isoleucine AUC Isoleucine AUA Isoleucine AUG Methionine (Start) ACU Threonine ACC Threonine ACA Threonine ACG Threonine AAU Asparagine AAC Asparagine AAA Lysine AAG Lysine AGU Serine AGC Serine AGA Arginine AGG Arginine U C A G G GUU Valine GUC Valine GUA Valine GUG Valine GCU Alanine GCC Alanine GCA Alanine GCG Alanine GAU Aspartate GAC Aspartate GAA Glutamate GAG Glutamate GGU Glycine GGC Glycine GGA Glycine GGG Glycine U C A G It would result in a shortened protein chain It would not have any change since there the genetic code degenerate It would result in an amino acid substitution It would result in a read through mutation
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD