Assume you have conducted a DNA sequencing reaction using the chain-termination (Sanger) method. You performed all the steps correctly and electrophoresced the resulting DNA fragments correctly, but when you looked at the sequencing gel, many of the bands were duplicated (in terms of length) in other lanes. What might have happened?
Added by Nancy R.
Step 1
Step 1: Improper DNA purification after the sequencing reaction can lead to contamination of the reaction components. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 68 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
You are performing a gel mobility shift assay. In lane 1 you run DNA alone as a control. In lane 2 you run DNA that has been incubated with your protein of interest. After you run the gel, you are surprised to see that the DNA fragments migrated the same distances on the gel in both lanes. What are some possible reasons for this? Select all that apply. Check All That Apply The protein doesn't bind to the DNA. The protein doesn't bind to the DNA. You ran a denaturing gel. You ran a denaturing gel. You forgot to add ethidium bromide. You forgot to add ethidium bromide.
Nimat P.
2. The DNA below shows the sequence of a template strand on top (with the ends labeled) and a sequencing primer on the bottom (with the ends not labeled, but shown correctly aligned with the template). 5' - AGTCGGATGTTGTACTGCATGGTACAATAGCATAAGCTGGAGTTTCTTATTCGATGCG - 3' CCATGTTATCGTATTCGA Assume that you have run a set of conventional Sanger dideoxy sequencing reactions using this combination of template and primer. You then run a denaturing polyacrylamide gel to analyze the four sequencing reactions and determine the sequence. Using the DNA sequences shown above, draw the sequencing gel results as you would expect it to appear at the end of electrophoresis. G A T C
Adi S.
DNA Sequencing The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label. (EQUATION CANNOT COPY) A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. 1. dATP, dTTP, dCTP, dGTP, ddTTP 2. dATP, dTTP, dCTP, dGTP, ddGTP 3. dATP, dCTP, dGTP, ddTTP 4. dATP, dTTP, dCTP, dGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like? (FIGURE CANNOT COPY)
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD