The concept of "essential" amino acids is directly linked to: 1. The ability of the body to synthesize them. 2. The dietary requirements of an organism. 3. The role of amino acids in protein structure. 4. The genetic code.
Added by Shahbaz A.
Close
Step 1
- Essential amino acids are those that cannot be synthesized by the body in sufficient quantities and therefore must be obtained from the diet. Show more…
Show all steps
Your feedback will help us improve your experience
Benjamin Densmore and 71 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
68. Which of the following statements is MOST likely to be true of nonpolar R groups in aqueous solution? A. They are hydrophilic and found buried within proteins B. They are hydrophobic and found on protein surfaces C. They are hydrophilic and found on protein surfaces D. They are hydrophobic and found within proteins 69. Which of the following BEST describes the essential amino acids? A. Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids B. Must be supplied in the diet because the human has an impaired ability to synthesize the carbon chain of the corresponding ketoacids C. Are identical in all species studied D. Are defined as those amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements 70. Which of the following BEST describes the biological value of a protein? A. The percentage of ingested protein utilized for protein synthesis in the body B. The percentage of ingested protein/nitrogen absorbed into the circulation C. The percentage of ingested protein/nitrogen in the body D. The gain in body weight per gram of protein ingested 51. Which of the following enzyme classes catalyze reactions in which two molecules are covalently connected to each other? A. Kinase B. Lyasae C Isomerase D Ligase 52. What are isoenzymes? A. Chemically, immunologically and electrophoretically different forms of an enzyme B. Different forms of an enzyme that are partially or totally similar in all properties C. Enzyme forms that are catalyzing different reactions but share the same coenzyme D. Forms of enzymes having the same tertiary and quaternary structures 53. What is an apoenzyme? A. The protein portion B. The non-protein group C It is a conjugated enzyme D It is a prosthetic group 54. Which of the following enzyme groups can catalyze oxidation reactions? A. Phosphorylases C. Dehydrogenases B. Isomerases D. Hydrolases 55. Which of the following is produced with the combination of apoenzyme and coenzyme? A. prosthetic group B. cofactor C. holoenzyme D enzyme substrate complex 56. Which of the following is true of enzymes' I - They increase the rate of reaction by stabilizing the transition state II - They raise activation energy to shift the equilibrium to favor the products III - They lower activation energy by altering the products of a reaction A I only B. III only C. I and II D. II and III 21. A transport protein is known to have the following structure a prosthetic group carries reduced iron while one moiety is composed of two alpha subunits and two beta subunits These components come together in order to form the larger functional protein. Based on this information. what is the level of protein structure being described, A Primary structure: the moieties simply refer to the amino acid chain that has a particular sequence. B. Secondary structure: the moieties are highly irregular in their arrangement. C Tertiary structure: I. polypeptide chains are arranged geometrically ordered units D Quaternary structure; the protein is formed by tetramers that are interlocked with one another. 22. What will initially change in an amino acid chain being synthesized in a cell if there was a point mutation? I - amino acid sequence II - amino acid composition II- hairpin loop IV - pseudoknot A. I only B. I, II C. I, II, III D. I, II, III, IV 24 What hierarchical structure of a protein is being shown in the illustration below? A. Primary B. Secondary B. Tertiary D. Quaternary 25. If an amino acid chain twists and turns into a tightly wound structure. choose the correct pairing of the hierarch. level of protein structure and the corresponding effect if additional steric hindrances occur as some side chains come into close proximity with each other. A Tertiary structure: the structure will become more stable B Secondary structure. the structure will become more stable C. Quaternary structure: the structure will become less stable D. Secondary structure: the structure will become less stable
Adi S.
In animals, the distinction between essential and non-essential amino acids generally has to do with: A. The oxidation state of their anomeric carbons B. Their glycogen storage potential C. The number of steps required to synthesize the amino acid D. Pyruvate E. Incorporation of nitrogen
Joanna Q.
The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT 5’ 5’ ACTTCGTATAATCATGGCTACAGCTTCGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand (top/bottom) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don't forget that there is always some 5' untranslated region encoded in the mRNA. Give the N and C ends of the protein.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD