Below is a diagram of a genetic disease pathway, whereby a TGA region (yellow) undergoes a repeat expansion (multiple TGA's inserted into the DNA) in the gene. This repeat expansion encodes for a mutated protein which results in detrimental health effects. Nucleic acid therapeutics can be used to target this disease at numerous stages. Identify and explain two possible ways (I have provided two of the same pages) in which this disease can be targeted. 1. Identify the therapeutic method used. a. Explain why you chose this method. b. What does the chosen therapeutic look like (structure, etc.)? Be as specific as possible. 2. Identify the location in the scheme below where the therapeutic will target. a. Update the diagram below to show how the chosen therapeutic will modulate the current disease pathway. b. Provide a detailed explanation, describing each step along the therapeutic pathway. NUCLEUS CYTOSOL mRNA DNA Transcription Splicing Nuclear export Translation pre-mRNA protein
Added by Linda S.
Close
Step 1
The therapeutic method used in this case is nucleic acid therapeutics. Show more…
Show all steps
Your feedback will help us improve your experience
Josee Pacheco and 53 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
DNA to DISEASE Procedure Step 1: The following table shows a partial DNA, mRNA, tRNA and amino acid sequence for part of a gene associated with a disease. Answer the following questions to gain insight on how to complete the sequences. Fill in the table below; include the 5' and 3' ends of each DNA/RNA sequence and the C terminal and N terminal ends for the amino acid sequences. Once the table is complete and you have obtained the single letter amino acid sequence, continue to step 2. Tip: you may want to use a pencil. 1.) mRNA may be transcribed from either strand of the DNA molecule. Therefore, it is important to determine which strand is the coding strand and which strand is the template strand. From the information in the table, are you able to identify which strand is which? How? 2.) What will be the only difference between the DNA coding strand sequence and the mRNA sequence? 3.) What will be the only difference between the DNA template sequence and the tRNA anticodon sequence? 4.) Which direction will our mRNA molecule be TRANSLATED: left to right or right to left? How do you know?
Josee P.
Shown below is the DNA sequence of a gene from a virus that encodes a short viral peptide. Also shown is the sequence of the mRNA synthesized from this gene. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Mature mRNA sequence (G* = 5’ G cap): 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' 1) In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene. 2) In the mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA. 3) Circle the start and stop codon in the mRNA. How many amino acids are in the viral peptide encoded by this gene? 4) Is this virus more likely to replicate in prokaryotic or eukaryotic cells? Briefly explain your reasoning.
Madhur L.
PROCEDURE 1. Below are DNA strands A and B with their polarity noted. RNA polymerase transcribes DNA making a new strand of RNA. Start transcription at the end of the molecule and transcribe strand B to make RNA strand C. Write the RNA nucleotides next to the letter A. Write down the polarity. Circle the last nucleotide added to the chain. A 5' ATGGTGCACCTGACTCCTGAGGAGAAGTCT B 3' TACCACGTGGACTGAGGACTCCTCTTCAGA C 5' AUGGUGCACCUGACUCCUGAGGAGAAGUCU 3' 2. Compare sequence A to C. The nucleotides of C is the same as in A. In A DNA have thymine instead of this in C have uracil because it is RNA. 3. Transcribe DNA strand E to make RNA strand F. Write down the polarity and circle the last nucleotide made. D 5' ATGGTGCACCTGACTCCTGTGGAGAAGTCT E 3' TACCACGTGGACTGAGGACACCTCTTCAGA F 5' AUGGUGCACCUGACUCCUGUGGAGAAGUCU 3' This sequence is the actual sequence from the beginning of the human beta globin gene. The most common sequence is A. The D sequence is from a copy of the gene that leads to sickle cell disease. The process in which RNA directs the synthesis of a protein is called translation. Use the genetic code table to translate mRNAs C and F. First copy the sequences C and F from above and then write the three-letter codes for the amino acids beneath the nucleotides. Group the three-letter codons by drawing parentheses or lines above them. Remember the translation machinery starts at the first AUG the ribosome sees. C F
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD
