1. Consider this bit of DNA from some gene: 5'-CGAGAGCTCATCCGA-3' 3'-GCTCTCGAGTAGGCT-5' The upper strand of the DNA is the transcription template. (a) (3 pts) Show the base sequence on the mRNA transcribed from the DNA. (mark 3' and 5' ends.) (b) (1 pts) How many codons are contained in this RNA? (c) (2 pts) When a ribosome translates the mRNA, which amino acid is inserted first into the polypeptide? (d) (1 pts) How many amino acids would be present in the finished polypeptide? (e) (2 pts) What is the anticodon of the tRNA which carried the last amino acid in the peptide? (mark 3' and 5' ends.)
Added by Ronald C.
Close
Step 1
First, we need to rewrite the given DNA sequence in a more readable format. The given DNA sequence is: 5'-CGAGAGCTCATCGGA-3' and 3'-GCTCTCGAGTAGGCC-5'. Show more…
Show all steps
Your feedback will help us improve your experience
Jennifer Hudspeth and 56 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Consider this bit of DNA from some gene: 5'-CGAGAGCTCATCCGA-3' 3'-GCTCTCGAGTAGGCT-5' The upper strand of the DNA is the transcription template. (a) (3 pts) Show the base sequence on the mRNA transcribed from the DNA. (mark 3' and 5' ends.) (b) (1 pts) How many codons are contained in this RNA? (c) (2 pts) When a ribosome translates the mRNA, which amino acid is inserted first into the polypeptide? (d) (1 pts) How many amino acids would be present in the finished polypeptide? (e) (2 pts) What is the anticodon of the tRNA which carried the last amino acid in the peptide? (mark 3' and 5' ends.)
Adi S.
Look at the following DNA region that codes for a specific gene: Coding strand: ATGTGCCCGAATGTTCTATAG Template strand: TACACGGGCTTACAAGATATC Write down the sequence of the mRNA that will be transcribed from this sequence: Using the Genetic code table, translate the mRNA into amino acids: How many codons does the mRNA have? How many amino acids does the polypeptide have? In eukaryotes, where do the processes of translation and transcription take place? Second letter: UUU - Phenylalanine UUC - Phenylalanine UUA - Leucine UUG - Leucine UCU - Serine UCC - Serine UCA - Serine UCG - Serine UAU - Tyrosine UAC - Tyrosine UGU - Cysteine UGC - Cysteine UAA - Stop codon UGA - Stop codon UAG - Stop codon UGG - Tryptophan CUU - Leucine CUC - Leucine CUA - Leucine CUG - Leucine CCU - Proline CCC - Proline CCA - Proline CCG - Proline CAU - Histidine CAC - Histidine CGU - Arginine CGC - Arginine CGA - Arginine CGG - Arginine CAA - Glutamine CAG - Glutamine AUU - Isoleucine AAU - Asparagine AGU - Serine ACU - Threonine AAC - Asparagine AGC - Serine AUC - Isoleucine ACC - Threonine AUA - Isoleucine ACG - Threonine AGA - Arginine AUG - Methionine ACG - Threonine AAG - Lysine AGG - Arginine GUU - Valine GCU - Alanine GAU - Aspartic acid GGU - Glycine GUC - Valine GCC - Alanine GAC - Aspartic acid GGC - Glycine GUA - Valine GCA - Alanine GAA - Glutamic acid GGA - Glycine GCG - Glutamic acid GUG - Valine GAG - Glutamic acid GGG - Glycine
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Watch the video solution with this free unlock.
EMAIL
PASSWORD