Question

Choose 3 different mutations that each cause a different change in charge*, and 2 that do not cause a charge change (5 mutations in total). Describe how these amino acid substitutions might affect the protein. This can just be based on the features of the amino acids and their general roles in proteins; you do not need to consult the Spike structure. (Do not consider indels such as "del142-144", only single a.a. substitutions.) * for example, you might choose a positive-to-neutral, a neutral-to-negative, and a negative-to-neutral change, but not two of the same type. Model answer (fictional): D86C. This removes a negative charge, and therefore the protein could lose an internal salt bridge or a salt bridge to another protein. The appearance of a Cys residue could alter the pattern of disulfide bonding, since this mutation is in the extracellular domain. Cys is also slightly smaller than Asp, but both are smal so the size change is less significant than the charge change. 

          Choose 3 different mutations that each cause a different
change in charge*, and 2 that do not cause a charge change (5
mutations in total). Describe how these amino acid substitutions
might affect the protein. This can just be based on the features of
the amino acids and their general roles in proteins; you do not
need to consult the Spike structure.
(Do not consider indels such as "del142-144", only single a.a.
substitutions.)
* for example, you might choose a positive-to-neutral, a neutral-to-negative, and a negative-to-neutral change, but not two of the same type.
Model answer (fictional):
D86C. This removes a negative charge, and therefore the protein
could lose an internal salt bridge or a salt bridge to another
protein. The appearance of a Cys residue could alter the pattern
of disulfide bonding, since this mutation is in the extracellular
domain. Cys is also slightly smaller than Asp, but both are smal
so the size change is less significant than the charge change.
Show more…
Choose 3 different mutations that each cause a different change in charge*, and 2 that do not cause a charge change (5 mutations in total). Describe how these amino acid substitutions might affect the protein. This can just be based on the features of the amino acids and their general roles in proteins; you do not need to consult the Spike structure. (Do not consider indels such as "del142-144", only single a.a. substitutions.) * for example, you might choose a positive-to-neutral, a neutral-to-negative, and a negative-to-neutral change, but not two of the same type. Model answer (fictional): D86C. This removes a negative charge, and therefore the protein could lose an internal salt bridge or a salt bridge to another protein. The appearance of a Cys residue could alter the pattern of disulfide bonding, since this mutation is in the extracellular domain. Cys is also slightly smaller than Asp, but both are smal so the size change is less significant than the charge change.

Added by Zachary R.

Close

Biology for AP Courses
Biology for AP Courses
Julianne Zedalis, John Eggebrecht
AceChat toggle button
Close icon
Ace pointing down

Please give Ace some feedback

Your feedback will help us improve your experience

Thumb up icon Thumb down icon
Thanks for your feedback!
Profile picture
Choose 3 different mutations that each cause a different change in charge*, and 2 that do not cause a charge change ( 5 mutations in total). Describe how these amino acid substitutions might affect the protein. This can just be based on the features of the amino acids and their general roles in proteins; you do not need to consult the Spike structure. (Do not consider indels such as "del142-144", only single a.a. substitutions.) for example, you might choose a positive-to-neutral, a neutral-to-negative, and a negative-to-neutral change, but not two of the same type. Model answer (fictional): D86C. This removes a negative charge, and therefore the protein could lose an internal salt bridge or a salt bridge to another protein. The appearance of a Cys residue could alter the pattern of disulfide bonding, since this mutation is in the extracellular domain. Cys is also slightly smaller than Asp, but both are smal so the size change is less significant than the charge change. Choose 3 different mutations that each cause a different change in charge*,and 2 that do not cause a charge change5 mutations in total).Describe how these amino acid substitutions might affect the protein.This can just be based on the features of the amino acids and their general roles in proteins;you do not need to consult the Spike structure. Do not consider indels such as"del142-144"only single a.a substitutions.) change,but not two of the same type Model answer (fictional): D86C.This removes a negative charge,and therefore the protein could lose an internal salt bridge or a salt bridge to another protein.The appearance of a Cys residue could alter the pattern of disulfide bonding,since this mutation is in the extracellular domain. Cys is also slightly smaller than Asp,but both are sma so the size change is less significant than the charge change
Close icon
Play audio
Feedback
Powered by NumerAI
Ivan Kochetkov Jennifer Stoner
Danielle Fairburn verified

Sukhwinder N and 60 other subject Biology educators are ready to help you.

Ask a new question
*

Labs

-

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs
*

Key Concepts

-
Key Concept
Premium Feature
Explore the core concept behind this problem.
Play button
Key Concept
Premium Feature
Explore the core concept behind this problem.
Your browser does not support the video tag.
*

Recommended Videos

-
exercise-3-assess-the-effect-of-mutation-in-the-dna-on-the-amino-acid-aa-code-because-genome-sequencing-cosis-jrc-decreasing-it-is-becoming-more-common-find-entire-rene-sequences-in-the-dna-94579

Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon! Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA Met Ala Asp Arg Ile Met 4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames! a. mRNA Reading frame 1: Protein possibility 1: b. mRNA Reading frame 2: Protein possibility 2: c. mRNA Reading frame 3: Protein possibility 3: 5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"? mRNA sequence: Protein sequence: 6. What type of mutation is this? Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation). 7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?

Sukhwinder N.
z0-which-the-followm-mutations-inost-likely-ciuse-phenotypic-change-rge-inversion-whose-ends-ae-each-in-intergenit-regions-nucienride-ubstirution-alon-codirg-transmembrne-doman-humeshiit-mul-77255

20) Which of the following mutations is most likely to cause a phenotypic change? 21) Which small-scale mutation would most likely have a catastrophic effect on the functioning of a protein? 22) What is the effect of a nonsense mutation in a gene? 23) When translating secretory or membrane proteins, ribosomes are directed to the ER membrane by 24) Which of the following is a useful feature of introns in eukaryotic cells? 25) Which of the following does not occur in prokaryotic gene expression, but does in eukaryotic gene expression? 26) What is the source of the extra chromosome 21 in an individual with Down syndrome?

Sri K.
for-the-following-questions-consider-these-known-facts-about-the-fole-0f-protcin-regulating-the-lysis-lysogeny-decision-lambda-phage-binding-of-protein-to-0-inhibits-transcription-of-th-cro-27774

For the following questions, consider these known facts about the role of cI protein in regulating the lysis/lysogeny decision in lambda phage: 1. Binding of cI protein to O_R1 inhibits transcription of the Cro gene. Thus, cI acts as a repressor of Cro gene transcription. 2. Interactions between cI protein bound to O_R2 and RNA polymerase bound to O_R3 (which also serves as the promoter for cI gene transcription) activate transcription of the cI gene. Thus, cI acts as an activator of cI gene transcription. 3. Transcription of the cI gene is inhibited by cI protein bound to O_R3. However, since the affinity of cI for O_R3 is weak, O_R3 is occupied by cI protein only when there is a high concentration of cI protein in the cell. E. If there is a burst of cI gene expression, which function of cI protein will be observed first? Why? F. What advantage might transcriptional inhibition confer when cI protein binds to O_R3? Why? cI protein exists as a dimer in solution and when bound to DNA (see Figure 3). cI dimers bind cooperatively to adjacent operator sites, one repressor dimer binding to each site. The term "cooperativity" refers in this case to a positively cooperative interaction in which the binding of a cI dimer to the high affinity OR1 site increases the affinity of a second dimer for the weaker OR2 site. Thus although the OR1 and OR2 sites differ in their affinities for cI by ~10-fold, two cI dimers bind simultaneously when OR1 and OR2 sites are adjacent (Figure 3). G. How might lambda phage benefit from the positively cooperative binding of cI to OR1 and OR2? H. cI proteins have two domains – the N-terminal domain, which contacts DNA, and the C-terminal domain, which mediates dimer formation and the cooperative interaction between dimers (Figure 3). What would happen to cI and Cro gene expression if the only available cI protein was truncated before the C-terminal domain, such that only the N-terminal domain remained? Why? Under normal circumstances, OR1 and OR2 are adjacent on the DNA, thus the C-terminal domains of a cI dimer bound to OR1 can interact with the C-terminal domains of a dimer bound to OR2 as shown schematically in Figure 3. Hochschild and Ptashne decided to ask what would happen to cooperative binding if the distance between OR1 and OR2 was increased.

Madhur L.
*

Recommended Textbooks

-
Biology for AP Courses

Biology for AP Courses

Julianne Zedalis, John Eggebrecht
achievement 1,367 solutions
Objective Biology for NEET

Objective Biology for NEET

Rajiv Vijay 1st Edition
achievement 1,584 solutions
Introduction to General, Organic and Biochemistry

Introduction to General, Organic and Biochemistry

Frederick A. Bettelheim, William H. Brown, Mary K. Campbell 12th Edition
achievement 1,757 solutions
*

Transcript

-
00:01 Hello students in question number 4 we have to calculate the protein sequence for the given template strand which is start with the 5 dash and c c c t a g tta triple g tac c a c a double c and a tc and so the 3 dash and so the mrr frame 1 will be starting with 3 -m g g -g a u this is a u c double a u c triple c and a u g u g u double -g and u a g u a g because in place of t the mrna sequence have u and so with the 5 -dh so for this the protein sequence will be espergillus, glycine, after this valine then pro and then the strop coatone.
01:55 Now for this was a part for b where the second frame for mrna starting with the 5 dash and it is aug gug, uac, c -cu -a -a -c -u -a -c and u -a -g with 3 -n.
02:29 So the protein sequence for this will be met, veline and asn and after this the stroke go down.
02:58 Now we will answer the c part with third mrna frame.
03:06 This is starting with the 5 -n u -g -g -u -a -d -c -u a -d -c -u -a -c -u -a -c -u -a -c -a -g and so the 3 -d -n now the protein sequence for the following mrna sequence this is trp this is for the following codones cys t -s t -r leucine thr and at the end arg.
03:51 Now for the question number 5 we have to tell what will happen if the structure of protein if dna base 11 which is g changed with t so for the question number 5 the dna after the mutation it will be cct ag t t t g, g triple, sorry, double t, aca and c, c, a, p c.
04:38 So up to the mutation, dna sequence is this.
04:41 Now the mrna sequence for this will be g, g, g, a, u -c -a, a -u -c, c -wc, c -w -a, u -g -u, and the last ag, and the protein sequence for this will be gly, glycline, serene, isolucine, gln, then cys and glycine at the end...
Need help? Use Ace
Ace is your personal tutor. It breaks down any question with clear steps so you can learn.
Start Using Ace
Ace is your personal tutor for learning
Step-by-step explanations
Instant summaries
Summarize YouTube videos
Understand textbook images or PDFs
Study tools like quizzes and flashcards
Listen to your notes as a podcast
Continue solving this problem
Create a free account to:
  • View full step-by-step solution
  • Ask follow-up questions with Ace AI
  • Save progress and study later
Continue Free
Numerade

Get step-by-step video solution
from top educators

Continue with Clever
or



By creating an account, you agree to the Terms of Service and Privacy Policy
Already have an account? Log In

A free answer
just for you

Watch the video solution with this free unlock.

Numerade

Log in to watch this video
...and 100,000,000 more!


EMAIL

PASSWORD

OR
Continue with Clever