Question

Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon! Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA Met Ala Asp Arg Ile Met 4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames! a. mRNA Reading frame 1: Protein possibility 1: b. mRNA Reading frame 2: Protein possibility 2: c. mRNA Reading frame 3: Protein possibility 3: 5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"? mRNA sequence: Protein sequence: 6. What type of mutation is this? Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation). 7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?

Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon!

Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA
Met Ala Asp Arg Ile Met

4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC
Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames!

a. mRNA Reading frame 1:
Protein possibility 1:
b. mRNA Reading frame 2:
Protein possibility 2:
c. mRNA Reading frame 3:
Protein possibility 3:

5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"?

mRNA sequence:
Protein sequence:

6. What type of mutation is this?
Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation).

7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?

Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon!

Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA
Met Ala Asp Arg Ile Met

4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC
Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames!

a. mRNA Reading frame 1:
Protein possibility 1:
b. mRNA Reading frame 2:
Protein possibility 2:
c. mRNA Reading frame 3:
Protein possibility 3:

5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"?

mRNA sequence:
Protein sequence:

6. What type of mutation is this?
Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation).

7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?

Added by Ryan J.

Question

Please give Ace some feedback