Question

Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown). 5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3' 3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5' * * (a) Identify and label the template and coding strands on the DNA. How did you determine this? Draw an arrow that indicates the direction of transcription. (b) If the *s indicate the start point and the end point in transcription, what is the resulting mRNA sequence? When you have finished transcribing, draw a box around the start codon and the stop codon. Underline the 5'UTR and the 3'UTR. (c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA sequence, beginning with the start codon. How many codons are present? (d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the polypeptide translated from this mRNA. How many amino acids are in this sequence? (e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation, imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P site and #5 in the A site (what do E, P, and A stand for? Draw the tRNAs that will be in each of these sites – E, P, and A showing the anticodon and the amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated in the example on the back: Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way: Tyr | A U A In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind the positions of amino acids during the elongation process for sites E and P. (f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new amino acid sequence that results from such a mutation. What type of mutation (silent – no effect, nonsense or missense) is this? (g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA. Which parts are missing on this DNA sequence? How would the mRNA sequence be different in eukaryotes vs prokaryotes?

Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown).

5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3'
3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5'
* *

(a) Identify and label the template and coding strands on the DNA. How did you determine
this? Draw an arrow that indicates the direction of transcription.

(b) If the *s indicate the start point and the end point in transcription, what is the resulting
mRNA sequence? When you have finished transcribing, draw a box around the start codon and
the stop codon. Underline the 5'UTR and the 3'UTR.

(c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA
sequence, beginning with the start codon. How many codons are present?

(d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the
polypeptide translated from this mRNA. How many amino acids are in this sequence?

(e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation,
imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P
site and #5 in the A site (what do E, P, and A stand for?

Draw the tRNAs that will be in each of these sites – E, P, and A showing the anticodon and the
amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated
in the example on the back:

Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way:

Tyr
|
A U A

In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind
the positions of amino acids during the elongation process for sites E and P.

(f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA
template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new
amino acid sequence that results from such a mutation. What type of mutation (silent – no effect,
nonsense or missense) is this?

(g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA.
Which parts are missing on this DNA sequence? How would the mRNA sequence be different in
eukaryotes vs prokaryotes?

Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown).

5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3'
3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5'
* *

(a) Identify and label the template and coding strands on the DNA. How did you determine
this? Draw an arrow that indicates the direction of transcription.

(b) If the *s indicate the start point and the end point in transcription, what is the resulting
mRNA sequence? When you have finished transcribing, draw a box around the start codon and
the stop codon. Underline the 5'UTR and the 3'UTR.

(c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA
sequence, beginning with the start codon. How many codons are present?

(d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the
polypeptide translated from this mRNA. How many amino acids are in this sequence?

(e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation,
imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P
site and #5 in the A site (what do E, P, and A stand for?

Draw the tRNAs that will be in each of these sites – E, P, and A showing the anticodon and the
amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated
in the example on the back:

Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way:

Tyr
|
A U A

In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind
the positions of amino acids during the elongation process for sites E and P.

(f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA
template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new
amino acid sequence that results from such a mutation. What type of mutation (silent – no effect,
nonsense or missense) is this?

(g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA.
Which parts are missing on this DNA sequence? How would the mRNA sequence be different in
eukaryotes vs prokaryotes?

Added by Brian W.

Biology for AP Courses

Julianne Zedalis, John Eggebrecht

Instant Answer

Solved by Expert Sri K

11/06/2022

Step 1

Determine the template strand by recognizing that it is the strand that is read by RNA polymerase during transcription in the 3' to 5' direction. The coding strand is the complementary strand to the template strand. Show more…

Show all steps

Thanks for your feedback!

Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown). 5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3' 3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5' * * (a) Identify and label the template and coding strands on the DNA. How did you determine this? Draw an arrow that indicates the direction of transcription. (b) If the *s indicate the start point and the end point in transcription, what is the resulting mRNA sequence? When you have finished transcribing, draw a box around the start codon and the stop codon. Underline the 5'UTR and the 3'UTR. (c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA sequence, beginning with the start codon. How many codons are present? (d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the polypeptide translated from this mRNA. How many amino acids are in this sequence? (e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation, imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P site and #5 in the A site (what do E, P, and A stand for? Draw the tRNAs that will be in each of these sites - E, P, and A showing the anticodon and the amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated in the example on the back: Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way: Tyr | A U A In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind the positions of amino acids during the elongation process for sites E and P. (f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new amino acid sequence that results from such a mutation. What type of mutation (silent – no effect, nonsense or missense) is this? (g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA. Which parts are missing on this DNA sequence? How would the mRNA sequence be different in eukaryotes vs prokaryotes?

Play audio

Feedback

Sri K and 61 other subject Biology educators are ready to help you.

Ask a new question

Labs

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs

Key Concepts

Recommended Videos

Recommended Textbooks

Transcript

00:01 Hello everyone in this question we have been given this dna strand and we need to identify and label the template and coding strand on the dna okay and then we have to tell how did you determine this and draw an arrow that indicates the direction of transcription okay so basically this three prime to five prime direction strand is the template strand okay and this is the anti -scent sense strand okay and this has polarity in the direction three prime to five prime direction and this only takes part in the transcription process okay as the rna polymerase reads the template in the direction three prime to five prime direction but makes the mrna in five prime to three prime direction okay 5 -fram to 3 -fram direction is basically the coding strand, okay? and this is also called the sense strand.

01:06 Okay, this has no role in the transcription process.

01:13 We have been said that this star as indicates the start point and this indicates the end point, okay, in transcription.

01:21 Then what is the resulting mrna sequence? okay.

01:24 And when you have finished transcribing draw a box around the start codon and the stop codon okay t will complementary with a a will be complementary with u because this is the mrna sequence in 5 prime to 3 prime direction so here instead of thiamine urosil will be present here we will write g here a here u u okay c here we write g here we write u okay then t then g then g then then you then you then you will write a here is u you then a then here we will light c here we will like c here we will like c here we will like c okay so let's write it here in proper manner here it will be in five times to 3 prime direction it will be a u g okay then we will have a u then we will have c g you then a g okay then u a c g c a g c a g g c a g g c a g g c u u a u a g g c u a g g c c u a a g a c g then g g a a c a c ua g ua g c g g a c g a c and this is the 3 primate so here basically we'll stop because we have been asked to stop here and this is the start codon okay and since we have started from the start codon only so we do not have 5 prime utr in it if we would have transcribed this sequence also then this portion would have been our 5 gram untranslated region okay and since we have here the stop codon that is u a okay this is the stop codon okay and here we have the start codon okay so that as this is the stop codon so after this between the 3 prime and the stop codon all this is basically 3 prime untranslated region and now we have to tell that the mrna sequence has how many tripled codons and we need to count it okay and we need to tell which of the codons codes for which okay which amino acids so here here we have one codon that is auuu this codes for iso -u -sin okay then we have c -g -u that codes for argyneen okay and then we have a -g -g that codes for argenin these both are synonymous codon that codes both the same amino acids okay uau codes for tyrosin then you codes for ucc here codes for argenine okay then agg here codes for argenine okay then g g here codes for glyc here codes for glyc okay and ua is the stop codon okay now in the next question we have been said that using so here we have one 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.

05:23 10 of the codons are present, including the start and stop codon.

05:29 Now, in the next question we have been said that consider the codons.

05:35 And here we have 1, 2, 3, 4, 5, 6, 7, 8.

05:41 8 of the codons here are basically, translating for the amino acids okay and aug here codes for formal methionine okay so this will also be counted so here we will have nine amino acids including the formal methionine the next question we have been said that consider the codon three four and five okay and one as the start codon okay in the marini's sequence during elongation imagine that the ribosome is positioned and these three codons with three being at the east side okay four being at the p side and five being at the a side okay so we know that ribosome has two subunits okay in the larger subunit we have exit site okay in the p side we have this is the peptidyl trans per site okay the a side that is amino acyl site okay so here the newly charged dna the newly charged dna appears here okay and at the p side the peptidal change is chain is grown okay and from the east side the peptideal chain exits and at the p side the initiation of the translation begins at the p side with the formal methionine being the first amino acid but the other charged amino acid appears at the a site to draw the anticoadone as well as the t rna sequence okay so let's say this is the five prime to three prime n okay and the first is the ug where the ribosomes binds okay and then we have the third one as cg the first u the first fourth one as a, g, g and the fifth one as uau.

07:56 So here is the large subunit and we have been said that the fifth one is on the a side, the fourth one is on the p side and the third one is on the e side, okay? so here we have the p site and here e side.

08:13 So the trna sequence that will be available here will be in the direction 3 -prime...

Ace is your personal tutor. It breaks down any question with clear steps so you can learn.

Start Using Ace

Continue solving this problem

Create a free account to:

View full step-by-step solution
Ask follow-up questions with Ace AI
Save progress and study later

Question

Please give Ace some feedback