Circle one: 210 or 212 Lab Section _____ AGA UUA AGC AGG UUG AGU GCA CGA GGA CUA CCA UCA ACA GUA GCC CGC GGC AUA CUC CCC UCC ACC GUC UAA GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA UUC CCG UCG ACG UAC GUG UAG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU UGA A R D N C E Q G H I L K M F P S T W Y V stop 6. You have the following double stranded DNA sequence: 5' - TCAATGTCGTTTGAGGAACCCATGGAAGCGA -3' 3' - AGTTACAGCAAACTCCTTGGGTACCTTCGCT -5' This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) What is the name of the enzyme that will make the RNA from this DNA sequence? (3 points) ii) If the top strand of this sequence is the template strand, write the sequence of the mRNA that is transcribed from this region. Label the 5' and 3' end of this molecule. (4 points) iii) If the DNA sequence above encodes the amino acid at the most N-terminus of the protein, what is the protein sequence encoded by the portion of the RNA you wrote out in part ii? Show your work for full credit. Be sure to label the N and C terminus of the protein sequence. (6 points) iv) What is the anticodon for the tRNA that will be at the A site of the ribosome when the first peptide bond for this protein is being catalyzed? (4 points) v) If a tRNA has an anticodon that is 5' - GUA -3', write the codon below. Label the 5' and 3' ends for full credit. (3 points) vi) What amino acid would the tRNA in 6v be bringing to the ribosome? Write out the full name of the amino acid for full credit. (2 points)
Added by Alicia A.
Close
Step 1
ii) If the top strand is the template strand, the mRNA sequence transcribed will be: 5'-AUG UAC GCA AAC UCU UGG GUA UUC GCU-3' iii) The protein sequence encoded by the portion of the RNA is: **N-Met-Tyr-Ala-Asn-Ser-Trp-Val-Phe-Ala-C** iv) The anticodon for the Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 90 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The top strand of the following segment of DNA serves as the template strand. We will refer to this segment of DNA as the original (or unmutated) sequence. 3’ TACACCTTGGCGACGACT 5’ 5’ ATGTGGAACCGCTGCTGA 3’ The original (unmutated) DNA sequence (above) has been mutated to the following (this represents the template strand): 3’ TACATCTTGGCGACGACT 5’. We will refer to this sequence as mutation #1. *Please note that for simplicity only the template strand for this mutated segment of DNA is shown. Answer the following questions: (a) What is the complete mRNA sequence for the mutated segment mutation #1? The mutated mRNA sequence is: 5' AUGAAGAACCGCUGCUCA 3'. **Please enter your sequence in the 5' to 3' direction.** (b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated. The amino acid sequence for this protein is N-terminus Met-Lys-Asn-Arg-Cys-Leu-Leu-Gly-Leu-Leu-Gly-Cys-Leu-Gly-Cys-Ala C-terminus. **Please note** The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein. i.e. input the amino acids in the order that they would be translated. If a codon encodes for a stop codon, type STOP. When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP). You will need to consult the genetic code to answer this question.
Sri K.
Below is part of a gene's DNA sequence (no promoter, introns or terminator are shown). 5' TACGATGATTCGTAGGTATTTACGCAGGGGCTAAGGGCAGACGGGAAACTAGCGAACC 3' 3' ATGCTACTAAGCATCCATAAATGCGTCCCCGATTCCCGTCTGCCCTTTGATCGCTTGG 5' * * (a) Identify and label the template and coding strands on the DNA. How did you determine this? Draw an arrow that indicates the direction of transcription. (b) If the *s indicate the start point and the end point in transcription, what is the resulting mRNA sequence? When you have finished transcribing, draw a box around the start codon and the stop codon. Underline the 5'UTR and the 3'UTR. (c) Using the mRNA sequence in (b), number and mark the triplet codons present in the mRNA sequence, beginning with the start codon. How many codons are present? (d) Using the mRNA sequence you transcribed, write the complete amino acid sequence of the polypeptide translated from this mRNA. How many amino acids are in this sequence? (e) Consider codons #3, #4 and #5 (start codon is #1) in the mRNA sequence. During elongation, imagine that the ribosome is positioned at these three codons with #3 in the E site, #4 in the P site and #5 in the A site (what do E, P, and A stand for? Draw the tRNAs that will be in each of these sites - E, P, and A showing the anticodon and the amino acid (if any) that is attached to the tRNA. Show the tRNA and its attachment as illustrated in the example on the back: Example: codon # 5 is UAU, therefore the tRNA in the A site can be illustrated this way: Tyr | A U A In the same way, illustrate the tRNAs in the E and the P site for codons #3 and #4. Keep in mind the positions of amino acids during the elongation process for sites E and P. (f) A mutation is produced in the above DNA sequence such that the codon ATC on the DNA template strand is mutated to TTC in the DNA. Write down the new mRNA sequence and the new amino acid sequence that results from such a mutation. What type of mutation (silent – no effect, nonsense or missense) is this? (g) Consider the same DNA sequence above. In reality it does not include some parts of the DNA. Which parts are missing on this DNA sequence? How would the mRNA sequence be different in eukaryotes vs prokaryotes?
DNA Coding GGT GAG AAT GAA ACT ATT TGC AGT DNA template CCA CTC TTA CTT TGA TAA ACG TCA Nucleus mRNA codon 5' GGU GAG AAU GAA ACU AUU UGC AGU tRNA codon 3' CCA CUC UUA CUU UGA UAA ACG UCA Nuclear pore AA 3-letter Gly Glu Asn Glu Thr Ile Cys Ser AA 1-letter G E N E T I C S Amino acid DNA mRNA tRNA What is the correct order of the Central Dogma DNA -> RNA -> Protein What is DNA made of? Nucleotides Where does transcription take place? Nucleus Where does translation take place? Cytoplasm New protein being built What are proteins made of? Amino Acids THE GENETIC CODE SECOND LETTER U C A G U UUU UUC Phe (F) UCU UCC Ser UUA UUG Leu (L) UCA UCG (S) UAU UAC Tyr (Y) UAA Ochre (terminator) UAG Amber (terminator) UGU UGC Cys (C) UGA Opal terminator UGG Trp(W) C CUU CUC Leu (L) CUA CUG CCU CCC Pro CCA (P) CCG CAU CAC His (H) CAA CAG Gln (Q) CGU CGC Arg (R) CGA CGG A AUU AUC Ile (I) AUA AUG Met (M) (initiator) ACU ACC Thr ACA (T) ACG AAU AAC Asn (N) AAA AAG Lys (K) AGU AGC Ser (S) AGA AGG Arg (R) G GUU GUC Val (V) GUA GUG (initiator) GCU GCC Ala GCA (A) GCG GAU GAC Asp (D) GAA GAG Glu (E) GGU GGC Gly (G) GGA GGG An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosome Cytoplasm Use the mRNA codon sequence and the genetic code table in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is AGU then the corresponding amino acid 3-letter is Serine (Ser) and the corresponding amino acid 1-letter is S. Created by Dr. Susan A. Holechek for BIO 340 (2019). Illustration by James Direen.
Marlyn J.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD