Consider the following nucleotide sequence. 5'-ATGTAAAATCAAAGAAAACCAACATCACATGCCGCCATGTAA-3' 3'-TACATTTTAGTTTCTTTTGGTTGTAGTGTACGGCGGTACATT-5' First, find the longest potential coding region specified by this nucleotide sequence. Use this sequence to answer the following: what would be the consequence of a mutation that changed the non-template strand sequence 5'-TTGAT-3' to 5'-TTGTT-3'? a) the mutation would result in a shorter protein b) the mutation would result in a different amino acid being inserted into the protein c) the mutation would result in a longer protein d) the amino acid sequence of the protein would not change e) none of the above
Added by Tony R.
Step 1
The longest potential coding region specified by this sequence is ATGTAAAATCAAAGAAAACCAACATCACATGCCGCCATGTAA. Show more…
Show all steps
Your feedback will help us improve your experience
Sana Riaz and 98 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Question: Consider the following coding DNA sequence specifying six amino acids in a protein: 3'TTATCTT CGGG A GA G AGAA A5' What are the amino acids? Thymine replaced with Uracil If a deletion of the first A occurs in the DNA and causes a frameshift mutation, what will change in the first five amino acids of the resulting protein? If a transversion takes place at the fourth nucleotide of the original sequence (third T from the 3' end), what changes may occur in the resulting protein synthesis?
Shaiju T.
When finished sequencing a DNA segment, you come across the new sequence below: 5' TCTTAGCGCATTGGACATGTAAGGCACGT 3' A) Identify the complementary sequence. B) If this is the beginning of a gene, which is the coding strand? C) Identify the mRNA sequence. D) Identify the protein sequence. E) If a base substitution occurred, converting the bold nucleotide to an 'A', what effect would that have on the protein sequence and function? D) Any other concerns?
Keemin L.
The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): $l$ $5^{\prime}-$ GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3" (a) What is the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA? (b) What is the amino acid sequence of the polypeptide encoded by this mRNA? (c) If the nucleotide indicated by the arrow undergoes a mutation that changes $T$ to $A$, what will be the resulting amino acid sequence following transcription and translation?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD