ecture18worksheetdna replicatior at the start of replicationthe two strands of a dna molecule un

Hi, so our question consists of various parts and in the first part it is asked that DNA synthes

Hi, the question is asking us draw two lines close together running parallel across the page to

Hello students, we have asked a multiple choice question two question and answers and 6 match th

Hello everyone, let's see our question. So, our first question is based on the given figure whic

Okay, so what happens is that it corrects it and moves on to the next nucleotide. So that these

Question

Lecture 18 Worksheet: DNA Replication At the start of replication, the two strands of a DNA molecule unwind to form a replication bubble with two replication forks, one on each side. 1. In the diagram below, label the 5' and 3' ends of the bottom strand of DNA. 2. All DNA polymerases synthesize a new DNA strand in a specific direction using an existing DNA strand as a template. Based on this fact, draw arrows in the two boxes below to show the direction of DNA polymerase movement on each strand. 3. Look at the replication fork on the left side of the bubble. The block arrow shows the direction that the fork is traveling (in other words, the DNA will continue to unwind in this direction). - Which of the two strands (A or B) is the leading strand? - Which is the lagging strand? - Which strand (A or B) is replicated continuously? - Which is replicated discontinuously? Label strands A and B below using these terms. 4. Now look at the replication fork on the right side of the bubble. For strands C and D, answer the questions in step 3 and label the diagram accordingly. 5. Let's start the replication process: Use different colors of ink to differentiate between DNA and RNA. Draw a short (3-4 nucleotide) RNA primer on each leading strand (one primer per fork). Make sure you use correct bases (A, U, G, C) to base-pair with DNA. The enzyme that makes these RNA primers is... 6. Now DNA polymerase III can start replication. Which end of the RNA primer will the polymerase use for DNA synthesis? Draw a newly synthesized DNA strand extending from each RNA primer. Indicate the polarity and direction of synthesis for these new DNA strands. 7. Repeat steps 5 and 6 for the lagging strands. A: GGGCATACGCAATATTCATTATCGAGGCGTCGATGACOGAATCGCA5' B: CTTAGCGT D: Page 1 of 2

Lecture 18 Worksheet: DNA Replication

At the start of replication, the two strands of a DNA molecule unwind to form a replication bubble with two replication forks, one on each side.

1. In the diagram below, label the 5' and 3' ends of the bottom strand of DNA.
2. All DNA polymerases synthesize a new DNA strand in a specific direction using an existing DNA strand as a template. Based on this fact, draw arrows in the two boxes below to show the direction of DNA polymerase movement on each strand.
3. Look at the replication fork on the left side of the bubble. The block arrow shows the direction that the fork is traveling (in other words, the DNA will continue to unwind in this direction).
- Which of the two strands (A or B) is the leading strand?
- Which is the lagging strand?
- Which strand (A or B) is replicated continuously?
- Which is replicated discontinuously?
Label strands A and B below using these terms.
4. Now look at the replication fork on the right side of the bubble. For strands C and D, answer the questions in step 3 and label the diagram accordingly.
5. Let's start the replication process: Use different colors of ink to differentiate between DNA and RNA. Draw a short (3-4 nucleotide) RNA primer on each leading strand (one primer per fork). Make sure you use correct bases (A, U, G, C) to base-pair with DNA. The enzyme that makes these RNA primers is...
6. Now DNA polymerase III can start replication. Which end of the RNA primer will the polymerase use for DNA synthesis? Draw a newly synthesized DNA strand extending from each RNA primer. Indicate the polarity and direction of synthesis for these new DNA strands.
7. Repeat steps 5 and 6 for the lagging strands.

A: GGGCATACGCAATATTCATTATCGAGGCGTCGATGACOGAATCGCA5'
B: CTTAGCGT

Page 1 of 2

ecture18worksheetdna replicatior at the start of replicationthe two strands of a dna molecule unwind to form a replication bubble with two replication forksone on each side 1 in the diagram 40954

Added by James H.

Question

Please give Ace some feedback