Given the following DNA code: TACGGATTCCCCGCTAAGACT, (a) provide the entire mRNA strand that would be transcribed from this DNA template strand; (b) what is the start codon? (c) what is the stop codon? (d) what is the first anti-codon? What is the sequence of amino acids that will result during the translation process? (e) which amino acid begins the "initiation" phase? (f) which amino acids in sequence make up the elongation phase? (g) which amino acid represents the "termination" phase?
Added by Mark A.
Step 1
Step 1:** Transcribe the DNA code TACGGATTCCCCGCTAAGACT to mRNA: AUGCCUAAAGGGGCUUUCUGA ** Show more…
Show all steps
Your feedback will help us improve your experience
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)? e) What is the amino acid sequence of the peptide?
Sri K.
The start codon refers to where _______ A. transcription begins B. the beginning of the protein is being encoded C. replication begins D. telomeres begin Which strand of DNA undergoes complementary basepairing with a piece of RNA that is being synthesized during transcription? A. Template strand B. Coding strand C. Anti-codon D. None of the above
Bryan V.
This is a segment of a DNA molecule. What are (a) the RNA codons, (b) the matching tRNA anticodons, and (c) the sequence of amino acids in the eventual protein?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD