I want to clone a gene within an E.coli environment but express it in a eukaryotic system like Saccharomyces cerevisiae, perhaps because the protein will need glycosylation. Which kind of vector would I need to employ?
Added by Stephen H.
Step 1
coli environment. ** Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 68 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Discuss how you can genetically engineer an E. coli cell to produce a human protein. Be sure to include in your answer the use of restriction enzymes, ligase; pUC19, X-gal, selective media, and a method for determining that your transgenic E. coli contains your human gene of interest and that it is producing the appropriate protein. Help, please.
Sri K.
You want to clone the following gene into the pBR322 vector. Explain how you will perform the cloning. How will you select for bacteria that is carrying the plasmid? (Remember if you insert within a gene in the plasmid it will be disrupted.) CGTGGATCCAGAATTCTATATACTAGCTAAGATG GCCGGATCCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTAC GGGCCTAGGCGAAACCCTTCTTAAGCCTAGG Role of Restriction Enzyme sites 2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow. (The normal sequence is above.) CGTGGATCCAGAATTCTATATACTAGCTAAGATG GCCGGATTCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTAC GGGCCTAAGCGAAACCCTTCTTAAGCCTAGG Explain how this mutation could potentially be corrected using a technique described in this module.
Human proteins can now be produced in bacteria such as $E .$ coli. However, one cannot simply introduce a human gene into $E .$ coli and expect it to be expressed. What steps must be taken to construct an $E .$ coli strain that will produce a mammalian protein such as human growth hormone?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD