Question

Locate the "gene" below based on finding a start codon sequence and a stop codon sequence. To get the correct answer you must pay close attention to the antiparallel nature of DNA and the direction in which RNA polymerase transcribes DNA. Once the gene is located, and the following intron is taken into consideration, determine the primary sequence of the polypeptide. Within the gene, the base sequence ³AAA? is an intron. ?TTT³ ³TATTCAATCGGATTCATGAATTTTGGAGATGATATCACGTATTCTAT? ?ATAAGTTAGCCTAAGTACTTAAAACCTCTACTATAGTGCATAAGATA? The amino acid sequence (starting with the first amino acid added) is:

          Locate the "gene" below based on finding a start codon sequence and a stop codon sequence. To get the correct answer you must pay close attention to the antiparallel nature of DNA and the direction in which RNA polymerase transcribes DNA. Once the gene is located, and the following intron is taken into consideration, determine the primary sequence of the polypeptide.

Within the gene, the base sequence ³AAA? is an intron.
?TTT³

³TATTCAATCGGATTCATGAATTTTGGAGATGATATCACGTATTCTAT?
?ATAAGTTAGCCTAAGTACTTAAAACCTCTACTATAGTGCATAAGATA?

The amino acid sequence (starting with the first amino acid added) is:

Locate the "gene" below based on finding a start codon sequence and a stop codon sequence. To get the correct answer you must pay close attention to the antiparallel nature of DNA and the direction in which RNA polymerase transcribes DNA. Once the gene is located, and the following intron is taken into consideration, determine the primary sequence of the polypeptide.

Within the gene, the base sequence ³AAA? is an intron.
?TTT³

³TATTCAATCGGATTCATGAATTTTGGAGATGATATCACGTATTCTAT?
?ATAAGTTAGCCTAAGTACTTAAAACCTCTACTATAGTGCATAAGATA?

The amino acid sequence (starting with the first amino acid added) is:

Added by Thomas A.

Question

Please give Ace some feedback