Only one of the two genes encodes a start codon. Identify this gene. Based on your identification, which gene encodes the ribosomal protein? The bottom gene (transcribed by a blue RNA polymerase) The top gene (transcribed by a green RNA polymerase)
Added by Alex L.
Step 1
Step 1: Identify the gene that encodes a start codon by examining the DNA sequence of both genes. Show more…
Show all steps
Your feedback will help us improve your experience
Md.Daniyal Arshad and 76 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Which of the two DNA Strands encodes a Start Codon? The Original Strand The Strand I synthesized
Md.Daniyal A.
Locate the "gene" below based on finding a start codon sequence and a stop codon sequence. To get the correct answer you must pay close attention to the antiparallel nature of DNA and the direction in which RNA polymerase transcribes DNA. Once the gene is located, and the following intron is taken into consideration, determine the primary sequence of the polypeptide. Within the gene, the base sequence ³AAA⁵ is an intron. ⁵TTT³ ³TATTCAATCGGATTCATGAATTTTGGAGATGATATCACGTATTCTAT⁵ ₅ATAAGTTAGCCTAAGTACTTAAAACCTCTACTATAGTGCATAAGATA₃ The amino acid sequence (starting with the first amino acid added) is:
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD