Essay title A1 Describe a genetic disorder that is caused by the mutation of a single gene. B1 Why do researchers use animal models rather than humans to obtain information about embryology? Provide an example of one animal model that is commonly used to investigate developmental events and describe the advantages and disadvantages of using this model. Please include references. You may also use figures if you wish but must cite references.
Added by Milagros J.
Close
Step 1
The example provided is Cystic Fibrosis (CF). Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Case: Cystic Fibrosis Cystic fibrosis is the most common lethal inherited disease in Caucasian populations. Cystic fibrosis is caused by a defect in the CFTR gene located on the q arm of Chromosome 7. In healthy individuals, the wild-type allele (R) is dominant and contains the information necessary for producing normal CFTR protein. CFTR is a protein that forms a channel in cell membranes that allows the movement of chloride ions out of cells. As chloride leaves cells, water follows and thins the mucus on cell surfaces, allowing it to flow freely. In individuals with cystic fibrosis, the CFTR proteins are defective and block the flow of chloride ions and water out of cells. The inability to regulate chloride and water results in drier mucus that is thick and sticky and accumulates on cell surfaces in the lungs, pancreas, digestive tract, and other internal organs. Individuals with cystic fibrosis experience frequent and serious bacterial infections, are unable to absorb adequate nutrients, and have chronic respiratory problems. If untreated, children with cystic fibrosis generally die before 5 years of age. However, daily chest pounding to clear mucus, along with heavy doses of antibiotics and other therapies, have extended life expectancy for cystic fibrosis patients into their 20s and 30s.
Sri K.
Cystic fibrosis is a hereditary disorder that results in difficulty breathing due to thick mucus in the lungs and digestive troubles due to decreased enzyme production in the pancreas. It is most commonly caused by a mutation in the CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) gene. The following is the template strand for a region of the CFTR gene that contains the mutation. The wild type version of the DNA is the template strand in a healthy individual. The CF version is the template strand in a person with the disease. Wild type DNA 3’ – CTTTTATAGTAGAAACCACAAAGGATA – 5’ CF DNA 3’ – CTTTTATAGTAGCCACAAAGGATA – 5’ a. Transcribe and translate both of the above pieces of DNA. Be sure to label the ends of each macromolecule (i.e. DNA with the 3’ and 5’ ends, and peptide with the C terminus and N terminus). Note that this region is merely a section from the middle of the coding sequence and is in the correct reading frame. There are no introns in the provided sequence. b. What type of mutation is represented in this disease? What effect does it have on the primary structure of the protein? What effect might it have on the tertiary structure of the protein? Explain your responses. c. Sometimes mutations affect gene regulation without altering the protein sequence. Describe one hypothesized situation that meets this criterion.
Keemin L.
GROUP A 1. Mr. and Ms. J have consulted a genetic counselor. Ms. J is 8 weeks pregnant, and cystic fibrosis runs in both of their families. Cystic fibrosis is a disease in which an individual may carry the disease allele but not have cystic fibrosis. A term to describe this type of trait is 2. First, the genetic counselor prepared a diagram summarizing the incidence of cystic fibrosis in the two families and the relationships between family members. This type of diagram is called a(n) 3. Mr. and Ms. J were then screened for the presence of the cystic fibrosis allele. It was determined that both Mr. and Ms. J have the allele even though they do not have cystic fibrosis. For the cystic fibrosis trait, they are both considered to be 4. Ms. J wanted to know if her baby would have cystic fibrosis. Cells were taken from the hairlike projections of the membrane that surrounds the embryo. This technique is called 5. The fetus was shown to carry one normal allele and one cystic fibrosis allele. The fact that the alleles are different means that they can be described as 6. As part of the prenatal screening, the chromosomes were obtained from cells in metaphase and photographed for analysis. This form of evaluation is called a(n) 7. The analysis revealed the presence of two XX chromosomes. The gender of the baby is therefore GROUP B 1. Mr. and Ms. B have a child with three copies of chromosome 21. The child has a chromosomal abnormality known as 2. This abnormality, like any change in DNA, is known as a(n) 3. Chromosome 21 is one of 22 pairs of chromosomes known as 4. The remainder of the child's chromosomes are normal. The total number of chromosomes in the child's cells is 5. The chromosome abnormality arose during the production of gametes. The form of cell division that occurs exclusively in germ cell precursors is called 6. The family knew in advance about their baby's chromosome abnormality because of prenatal screening and testing. The first indication was an abnormal accumulation of fluid at the back of the fetus's neck. This test, which uses ultrasound, is known as the
Marisa A.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD