Question 22 (1 point) Suppose a translocation results in a gene that was in an area of heterochromatin being moved into an area of euchromatin. What is the likely effect on gene expression? a) Transcription of the gene will decrease. b) Transcription of the gene will increase. c) Transcription of the gene will not change. d) Transcription of the gene take place in the opposite direction on the DNA strand. Question 23 (2 points) Place the following steps of the central dogma of molecular biology in order. DNA is used as a template to make RNA. mRNA is used by the ribosome as instructions to build a protein. Protein can affect the phenotype(s) of the organisms. RNA is spliced to remove introns, along with additional processing.
Added by Santiago D.
Close
Step 1
** Show more…
Show all steps
Your feedback will help us improve your experience
Shaiju T and 58 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If transcription could proceed in both directions along both DNA strands of a gene, how many different polypeptides could be coded for by a single gene? 1 2 3 4 None Suppose a tRNA molecule bearing the anticodon for cysteine, and with cysteine bound to it, is chemically treated so as to change the cysteine to alanine (the tRNA molecule and the anticodon remain unaltered). Which of the following is likely to be true? Alanine would be incorporated into the peptide in place of cysteine Cysteine would continue to be brought to the ribosome by this tRNA Transcription would stop when this tRNA molecule entered the ribosome The amino acid bound to this tRNA would not be added to the growing polypeptide. The result would differ.
Tracy L.
The following gene sequence appears on one strand of a segment of DNA that is about to go through DNA Replication. What code will DNA Polymerase build to make the complementary strand? TACGGCATATGCAAATGGCGAGCCTATATT
Madhur L.
Genes can be transcribed into $\mathrm{mRNA}$, in the case of protein-coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units. i. Found in eukaryotes ii. Contain introns iii. Capable of making only a single protein from a given gene
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD