QUESTION 4: (10 marks) Below is the DNA strand that will be used for the transcription process. 5' CTATAAGGCGCAAATCCCTGCCAT 3' (a) Write the mRNA sequence that would result from transcription of the DNA sequence. Indicate the 5' and 3' ends of the mRNA. (4 marks) (b) Name the enzyme that responsible for transcription process in prokaryotic cell. Briefly explain the properties of this enzyme. (3 marks) (c) Write the polypeptide sequence that would be translated from your mRNA sequence. Indicate the amino ($NH_3^+$) and carboxy ($COO^-$) termini of the protein. (3 marks)
Added by Antonia J.
Close
Step 1
During transcription, the DNA double helix unwinds, and one strand serves as a template for the synthesis of a complementary mRNA molecule. The mRNA sequence is identical to the coding strand of DNA, except that uracil (U) replaces thymine (T). The given DNA Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 68 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
3’ - TAC AAA GAG GAT CCG ACC TCA ACT - 5” 1. Transcribe the DNA sequence into the mRNA sequence and label its 5' and 3' ends. 2. What is the full name (extended version) of the enzyme that performs this process? 3. The DNA template for transcription is only one strand of the DNA double helix. How do we know that the mRNA is not based on the sequence of the other DNA strand? 4. What is the anticodon sequence of the tRNA that binds to the fourth codon of this mRNA? 5. Translate the mRNA sequence into the amino acid sequence (use the genetic code table). 6. How many amino acids does this protein have? 7. Can we tell if this protein was synthesized in a bacterial cell versus eukaryotic cell?
Adi S.
QUESTION 4: (10 marks) Consider the example of a DNA molecule that codes for the 5' end of an mRNA with the following sequence (letters in uppercase represent exons; italicized letters represent introns): 5' ATATTAT TTTACGGGAATTATGGAGTAGGTAAGAGTCGCACCTATTAGGATANCTAMA 5' a) Because this is a eukaryote, where are the sequences of DNA that control the binding of enzymes and proteins needed for initiation of transcription? b) Assume that transcription starts immediately from the 6th leftmost base. Write the sequence of the primary RNA transcript, including the polarity of the transcript. Indicate the 5' and 3' ends of the mRNA. Be careful in this step, because the questions below will depend on your correct transcription. c) How many nucleotides are added in the introns of the mRNA?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD