Question

Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the amino acid sequence for one of these enzymes is: Methionine-Proline-Tryptophan-Alanine-Glutamine-Lysine-Cysteine The gene was sequenced and found to have the following nucleotide sequence on the DNA template strand for the part of the gene coding for these amino acids: TAC GGA ACC CGG GTT TTT ACG A series of mutants for this enzyme was recovered and found to have the following nucleotide sequences on the DNA template strand. Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Mutant 1: TAC GGA ACC GGG GTT TTT ACG Missense mutation Mutant 2: TAC GGA ACT CGG GTT TTT ACG Nonsense mutation Mutant 3: TAC GGA ACC GGG TTT TTA CG Frameshift mutation Mutant 4: TAC GGA ACC CGT GTT TTT ACG Silent mutation

          Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the amino acid sequence for one of these enzymes is:
Methionine-Proline-Tryptophan-Alanine-Glutamine-Lysine-Cysteine
The gene was sequenced and found to have the following nucleotide sequence on the DNA template strand for the part of the gene coding for these amino acids:
TAC GGA ACC CGG GTT TTT ACG
A series of mutants for this enzyme was recovered and found to have the following nucleotide sequences on the DNA template strand. Choose the correct type of mutation
that occurred in the DNA to produce each mutant type.
Mutant 1: TAC GGA ACC GGG GTT TTT ACG Missense mutation
Mutant 2: TAC GGA ACT CGG GTT TTT ACG Nonsense mutation
Mutant 3: TAC GGA ACC GGG TTT TTA CG Frameshift mutation
Mutant 4: TAC GGA ACC CGT GTT TTT ACG Silent mutation
        
Show more…
Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the amino acid sequence for one of these enzymes is:
Methionine-Proline-Tryptophan-Alanine-Glutamine-Lysine-Cysteine
The gene was sequenced and found to have the following nucleotide sequence on the DNA template strand for the part of the gene coding for these amino acids:
TAC GGA ACC CGG GTT TTT ACG
A series of mutants for this enzyme was recovered and found to have the following nucleotide sequences on the DNA template strand. Choose the correct type of mutation
that occurred in the DNA to produce each mutant type.
Mutant 1: TAC GGA ACC GGG GTT TTT ACG Missense mutation
Mutant 2: TAC GGA ACT CGG GTT TTT ACG Nonsense mutation
Mutant 3: TAC GGA ACC GGG TTT TTA CG Frameshift mutation
Mutant 4: TAC GGA ACC CGT GTT TTT ACG Silent mutation

Added by Lisa L.

Close

Biology for AP Courses
Biology for AP Courses
Julianne Zedalis, John Eggebrecht
AceChat toggle button
Close icon
Ace pointing down

Please give Ace some feedback

Your feedback will help us improve your experience

Thumb up icon Thumb down icon
Thanks for your feedback!
Profile picture
Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the amino acid sequence for one of these enzymes is: Methionine-Proline-Tryptophan-Alanine-Glutamine-Lysine-Cysteine Time left 0:48:22 The gene was sequenced and found to have the following nucleotide sequence on the DNA template strand for the part of the gene coding for these amino acids: TAC GGA ACC CGG GTT TTT ACG A series of mutants for this enzyme was recovered and found to have the following nucleotide sequences on the DNA template strand. Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Mutant 1: TAC GGAACC GGG GTT TTT ACG Mutant 2: TAC GGAACT CGG GTT TTTACG Nonsense mutation Mutant 3: TAC GGAACC GGG TTT TTA CG Frameshift mutation Mutant 4: TAC GGAACC CGT GTT TTT ACG
Close icon
Play audio
Feedback
Powered by NumerAI
Danielle Fairburn Kathleen Carty
Jennifer Stoner verified

Adi S and 84 other subject Biology educators are ready to help you.

Ask a new question

*

Labs

-

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs

*

Key Concepts

-
Key Concept
Premium Feature
Explore the core concept behind this problem.
Play button
Key Concept
Premium Feature
Explore the core concept behind this problem.
Your browser does not support the video tag.

*

Recommended Videos

-
question-17-5-pts-the-amino-acid-sequences-shown-in-the-following-table-were-obtained-from-the-central-region-of-a-particular-polypeptide-chain-in-the-wild-type-wt-and-several-mutant-bacteri-13151

The amino acid sequences shown in the following table were obtained from the central region of a particular polypeptide chain in the wild-type (WT) and several mutant bacterial strains (the whole protein is not shown, just an internal segment of it). Each mutant strain has a point mutation in the gene that produces this polypeptide. Each mutant strain depicted contains only one mutation. A blank box indicates no amino acid codon exists in that position. Codon 1 2 3 4 5 6 7 8 9 WT Phe Leu Pro Thr Val Thr Thr Arg Trp Mutant 1 Phe Leu His His Gly Asp Asp Thr Val Mutant 2 Phe Leu Pro Thr Met Thr Thr Arg Trp Mutant 3 Phe Leu Pro Thr Val Thr Thr Arg Mutant 4 Phe Leu Pro Arg Mutant 5 Phe Leu Pro Ser Val Thr Thr Arg Trp For each of the mutants, fill in the table below indicating what kind of mutation has occurred: missense, nonsense, synonymous, or frameshift, and in which codon (1-9) the mutation occurred. You do not need to distinguish between conservative and nonconservative missense mutations. Type of mutation Codon where mutation occurred Mutant 1 Mutant 2 Mutant 3 Mutant 4 Mutant 5

Adi S.

exercise-3-assess-the-effect-of-mutation-in-the-dna-on-the-amino-acid-aa-code-because-genome-sequencing-cosis-jrc-decreasing-it-is-becoming-more-common-find-entire-rene-sequences-in-the-dna-94579

Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon! Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA Met Ala Asp Arg Ile Met 4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames! a. mRNA Reading frame 1: Protein possibility 1: b. mRNA Reading frame 2: Protein possibility 2: c. mRNA Reading frame 3: Protein possibility 3: 5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"? mRNA sequence: Protein sequence: 6. What type of mutation is this? Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation). 7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?

Sukhwinder N.

suppose-you-are-studying-the-isoleucine-trna-synthetase-from-the-bacterium-e-coli-you-have-cloned-the-isoleucine-trna-synthetase-and-created-a-set-of-mutant-genes-that-alter-the-amino-acid-s-00334

Suppose you are studying the isoleucine-tRNA synthetase from the bacterium E. coli. You have cloned the isoleucine-tRNA synthetase and created a set of mutant genes that alter the amino acid sequence of the enzyme in different locations. Details of the different mutations are given in the table below. Gene Amino acid position Amino acid change Wild-type (wt) none Mutant 1 (m1) 97 glycine to arginine Mutant 2 (m2) 183 lysine to alanine Mutant 3 (m3) 241 threonine to alanine Mutant 4 (m4) 242 threonine to proline Mutant 5 (m5) 243 threonine to alanine Mutant 6 (m6) 246 threonine to alanine You transform an E. coli strain that has a normal isoleucine-tRNA synthetase gene on its chromosome with plasmids containing each of the mutant genes you created. The mutant gene is under the control of a relatively weak promoter. This ensures that the transformed E. coli can still grow, even if the mutant isoleucine-tRNA synthetase is non-functional, because the bacterial still has its normal chromosomal isoleucine-tRNA synthetase as well. Next you purify the protein glucose-6-phosphate isomerase from each of the transformed E. coli strains and analyze the amino acid content of the purified proteins. The relative amounts of isoleucine and valine are shown in the figure below. Given the data presented above, which amino acids are involved in the editing activity of isoleucine-tRNA synthetase?

Supreeta N.


*

Recommended Textbooks

-
Biology for AP Courses

Biology for AP Courses

Julianne Zedalis, John Eggebrecht
achievement 1,680 solutions
Objective Biology for NEET

Objective Biology for NEET

Rajiv Vijay 1st Edition
achievement 1,314 solutions
Introduction to General, Organic and Biochemistry

Introduction to General, Organic and Biochemistry

Frederick A. Bettelheim, William H. Brown, Mary K. Campbell 12th Edition
achievement 1,639 solutions

*

Transcript

-
00:01 Mutant 1 mutant 1 occurs in frame shift frame shift frame shift mutation in third position third position and second one mutant to missense mutation missense mutation which is in? fifth codon fifth codon and the third is mutant 3 mutant 3 occurs in nonsense mutation nonsense mutation which is in the ninth codon and the fourth is mutant 4 mutant 4 occurs in nonsense and missense nonsense and missense mutation which is fourth and fifth codon fourth and fifth codon if we consider if we have chosen only one that is nonsense mutation and the fifth is mutation 5 mutant 5 occurs in missense mutation missense mutation that is fourth codon...
Need help? Use Ace
Ace is your personal tutor. It breaks down any question with clear steps so you can learn.
Start Using Ace
Ace is your personal tutor for learning
Step-by-step explanations
Instant summaries
Summarize YouTube videos
Understand textbook images or PDFs
Study tools like quizzes and flashcards
Listen to your notes as a podcast
Continue solving this problem
Create a free account to:
  • View full step-by-step solution
  • Ask follow-up questions with Ace AI
  • Save progress and study later
Continue Free
Join the community

18,000,000+

Students on Numerade


Trusted by students at 8,000+ universities

Numerade

Get step-by-step video solution
from top educators

Continue with Clever
or



By creating an account, you agree to the Terms of Service and Privacy Policy
Already have an account? Log In

A free answer
just for you

Watch the video solution with this free unlock.

Numerade

Log in to watch this video
...and 100,000,000 more!


EMAIL

PASSWORD

OR
Continue with Clever