Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the amino acid sequence for one of these enzymes is: Methionine-Proline-Tryptophan-Alanine-Glutamine-Lysine-Cysteine The gene was sequenced and found to have the following nucleotide sequence on the DNA template strand for the part of the gene coding for these amino acids: TAC GGA ACC CGG GTT TTT ACG A series of mutants for this enzyme was recovered and found to have the following nucleotide sequences on the DNA template strand. Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Mutant 1: TAC GGA ACC GGG GTT TTT ACG Missense mutation Mutant 2: TAC GGA ACT CGG GTT TTT ACG Nonsense mutation Mutant 3: TAC GGA ACC GGG TTT TTA CG Frameshift mutation Mutant 4: TAC GGA ACC CGT GTT TTT ACG Silent mutation
Added by Lisa L.
Close
Your feedback will help us improve your experience
Adi S and 84 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The amino acid sequences shown in the following table were obtained from the central region of a particular polypeptide chain in the wild-type (WT) and several mutant bacterial strains (the whole protein is not shown, just an internal segment of it). Each mutant strain has a point mutation in the gene that produces this polypeptide. Each mutant strain depicted contains only one mutation. A blank box indicates no amino acid codon exists in that position. Codon 1 2 3 4 5 6 7 8 9 WT Phe Leu Pro Thr Val Thr Thr Arg Trp Mutant 1 Phe Leu His His Gly Asp Asp Thr Val Mutant 2 Phe Leu Pro Thr Met Thr Thr Arg Trp Mutant 3 Phe Leu Pro Thr Val Thr Thr Arg Mutant 4 Phe Leu Pro Arg Mutant 5 Phe Leu Pro Ser Val Thr Thr Arg Trp For each of the mutants, fill in the table below indicating what kind of mutation has occurred: missense, nonsense, synonymous, or frameshift, and in which codon (1-9) the mutation occurred. You do not need to distinguish between conservative and nonconservative missense mutations. Type of mutation Codon where mutation occurred Mutant 1 Mutant 2 Mutant 3 Mutant 4 Mutant 5
Adi S.
Exercise 3: Assess the effect of a mutation in the DNA on the Amino Acid (AA) code. Because genome sequencing costs are decreasing, it is becoming more common to find entire gene sequences in the DNA, and to use that sequence to predict the effects of mutations. To predict the effect of a mutation, you need to be able to figure out where the translation of an mRNA will start. Since all genes start with a methionine (Met) encoded by an AUG "start codon", all you have to do is scan the sequence 5' to 3' for the first AUG. When you find it, you know the reading frame! Any other AUG's in that frame are just additional methionine amino acids. When you reach a stop codon in that frame, you stop translating. Using the sequence from the reading frame example on the first page, we see that reading frame #3 provides the first AUG start codon (typed below again for convenience). We also see that a second AUG is just translated as a second methionine (Met) amino acid, and the translation stops at a UAA stop codon. Note that, unlike exercise #1, in this exercise you don't translate the mRNA into an amino acid sequence unless you find a start codon! Reading frame 3: AA AUG GCC GAC CGA AUA AUG UAA AA Met Ala Asp Arg Ile Met 4. What protein(s) could be made from the following DNA template strand? CCTAGTTAGGGTACACCATC Remember, you have to figure out what the 5'-3' mRNA sequence is before you look at reading frames! a. mRNA Reading frame 1: Protein possibility 1: b. mRNA Reading frame 2: Protein possibility 2: c. mRNA Reading frame 3: Protein possibility 3: 5. What would happen to the structure of this protein if DNA base #11 ("G") were changed to a "T"? mRNA sequence: Protein sequence: 6. What type of mutation is this? Note: A missense mutation changes 1 amino acid. A silent mutation doesn't change the amino acid code (because the code is degenerate/redundant)! A nonsense mutation creates a new stop codon. A frame shift mutation (deletion or insertion) changes all of the amino acids downstream (after the mutation). 7. Suppose this is part of the sequence for a gene encoding a protein that halts the cell cycle if DNA is damaged. What could happen as a result of this mutation?
Sukhwinder N.
Suppose you are studying the isoleucine-tRNA synthetase from the bacterium E. coli. You have cloned the isoleucine-tRNA synthetase and created a set of mutant genes that alter the amino acid sequence of the enzyme in different locations. Details of the different mutations are given in the table below. Gene Amino acid position Amino acid change Wild-type (wt) none Mutant 1 (m1) 97 glycine to arginine Mutant 2 (m2) 183 lysine to alanine Mutant 3 (m3) 241 threonine to alanine Mutant 4 (m4) 242 threonine to proline Mutant 5 (m5) 243 threonine to alanine Mutant 6 (m6) 246 threonine to alanine You transform an E. coli strain that has a normal isoleucine-tRNA synthetase gene on its chromosome with plasmids containing each of the mutant genes you created. The mutant gene is under the control of a relatively weak promoter. This ensures that the transformed E. coli can still grow, even if the mutant isoleucine-tRNA synthetase is non-functional, because the bacterial still has its normal chromosomal isoleucine-tRNA synthetase as well. Next you purify the protein glucose-6-phosphate isomerase from each of the transformed E. coli strains and analyze the amino acid content of the purified proteins. The relative amounts of isoleucine and valine are shown in the figure below. Given the data presented above, which amino acids are involved in the editing activity of isoleucine-tRNA synthetase?
Supreeta N.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD