The DNA used above was mutated during replication prior to cell division. Here is the original strand and the mutant strand. Will their protein products be different from one another? If so, how? Original DNA: 5' TACCAAAAAGGGCGAACAAATAAAATT 3' Mutant DNA: 5' TACCAAAAAGGGCGAACTAATAAAATT 3' Same; The mutation occurs outside of the coding region so it doesn't affect the protein at all. Same; The mutation is silent since the new codon codes for the same amino acid Different; The mutation changes the codon to a different amino acid which changes how the protein forms. Different; The mutation has a stop codon where one didn't exist before causing the protein to be shorter than it normally would
Added by David S.
Close
Step 1
Step 1:** Convert the original DNA sequence into mRNA: Original DNA: 5'TACCAAAAAGGGCGAACAAATAAAATT 3' mRNA: 3'AUGGUUUUCCCGCUUGUUUAUUUUAAU 5' ** Show more…
Show all steps
Your feedback will help us improve your experience
Krishna G and 51 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
For each different mutant cell described below, assume that ONE nucleotide has been mutated in the sequence so that the protein's function has changed. Name as many single nucleotide changes that could result in the description. Cell 2: Many different types of proteins are too short but have the correct sequence up to the point which the amino acid sequence just stops. Insertion mutation that creates longer amino acid chains Nonsense Mutation caused by the creation of a new stop codon. Silent mutation that changes the codons but not the amino acids Missense mutation caused by a different amino acid than the original version
Farhan A.
Sometimes mutations are silent, having no effect on the protein produced. Other times, the mutation can have a serious impact on the protein that is produced. Return to your original DNA strand. Below, is a mutated copy of that strand. Both of the following mutations are point mutations; that is, one nucleotide is substituted, added, or deleted. DNA T A C A T G T A T C A G A C G A C C C C C G A C A T C mRNA Amino acids Figure 0.6 Translating the mRNA message from mutated DNA into a polypeptide Enter the complimentary mRNA sequence into Figure 12.6. Use the genetic code to determine which amino acids will be needed and in what order they will be delivered to the ribosome. Using the genetic code from Figure 12.5, complete the diagram in Figure 12.6. Study Figure 12.6 carefully. Check this version of the DNA with the original base by base until you find the mutation. Locate the mutation and circle it. What type of mutation occurred here? Compare the protein produced by this mutated sequence to the original protein (seen in Figure 12.4). Do you think this new protein will function the same as the original one? Why or why not?
Lauren L.
A mutation in DNA generates a UGA stop codon in the middle of the mRNA coding for a particular protein. A second mutation in the cell's DNA leads to a single nucleotide change in a tRNA that allows the correct translation of this protein; that is, the second mutation 'suppresses" the defect caused by the first. The altered tRNA translates the UGA as tryptophan. What nucleotide change has probably occurred in the mutant tRNA molecule? What consequences would the presence of such a mutant tRNA have for the translation of the normal genes in this cell?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD