Question 5 1 pts The letters A to D represent a mutation in the DNA sequence. Specifically they represent a deletion of 3 nucleotides. Which of the mutations would be considered an allele of the gene? +1 Gene RNA-coding region DNA Coding strand 5' Template strand 3' A B C D 3' D 5' Terminator AB C regulatory region Promoter Transcription mRNA 5' Start codon 5' UTR Stop codon 3' 3' UTR Polypeptide H?N Amino terminal (N-terminus) Translation COOH Carboxyl terminal (C-terminus)
Added by Michael M.
Close
Step 1
Step 1: The question asks which of the mutations would be considered an allele of the gene. Show more…
Show all steps
Your feedback will help us improve your experience
Sana Riaz and 67 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Examine the Figure below: The letters A to D represent a mutation in the DNA sequence. Specifically, they represent a deletion of 2 nucleotides in the DNA sequence. Which of the mutations (A-D) will likely affect the final polypeptide (could affect abundance and/or amino acid sequence and/or function)? Select all correct answers:
Sana R.
Strands A, B, and C represent DNA mutations from the template strand. For each of the following mutations, choose one strand (A, B, or C) that matches the terms below. (Answers may be used once, more than once, or not at all.) Template Strand: 3' CCATGCTACATC 5' A: 3' CCAAGCTACATC 5' B: 3' CCATACATC 5' C: 3' CATGCTACAAAATC 5' Point Mutation Frameshift Mutation Deletion Mutation Insertion Mutation
Sri K.
The following DNA sequence includes the end of the last exon of a protein-coding gene: 5' CATCAATTTGGTACTCCGTCCATTTTTCC 3' GTAGTTAAACCATGAGGCAGGTAAAAAGG 5' (a) Find and mark the STOP codon, which will determine the correct CODING strand and reading frame. (b) Give the 5' to 3' mRNA sequence that would be transcribed from this DNA sequence; label the 5' and 3' ends. (c) Give the amino acid sequence (three-letter abbreviations) that would be translated from the correct message; label the N and C ends. How many amino acids are there?
Shaiju T.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD