Using the DNA strand below, create an mRNA transcript and use that mRNA transcript to create a protein. 3’ G T T C T A C G A C G T T G C A A T A G C T T A A A T C G C C 5’ What is the effect of having the second C turned into an A nucleotide? What type of mutation is this? What is the effect of changing the second T to an A? How would you describe this mutation? What is the effect of mutating the fourth T to a C and what type of mutation is this? Re-transcribe and retranslate the protein if an insertion of an A nucleotide were to occur after the second C. What type of mutation is this?
Added by Thomas R.
Step 1
First, we need to find the template strand for transcription. Since the given DNA strand has a 3' to 5' direction, it is the template strand. Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 89 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Using the DNA strand below, create an mRNA transcript and using that mRNA transcript create a protein. 3' G T T C T A C G A C G T T G C A A T A G C T T A A A T C G C C 5' What is the effect of having the second C turned to an A nucleotide? What type of mutation is this? What is the effect of changing the second T to an A? How would you describe this mutation? What is the effect of mutating the fourth T to a C and what type of mutation is this?
Adi S.
Consider the following DNA sequence in a coding region of a gene: 5’ – ATGAAAGAGGAGTCC – 3’ 3’ – TACTTTCTCCTCAGG – 5’ 1) Using the top strand as the coding strand, what would be the sequence of the transcribed mRNA? 2) Using the genetic code, what is the amino acid sequence of this polypeptide? 3) A point mutation occurs at the position underlined. The DNA sequence is now this: 5’ – ATGAAAGCGGAGTCC – 3’ 3’ – TACTTTCGCCTCAGG – 5’ How does this mutation affect the amino acid sequence of the protein? (write the new amino acid sequence) 4) The insertion of a base causes a(n) ___________________________ mutation.
Madhur L.
Use the genetic code chart to help you transcribe and translate a DNA sequence. Initial DNA sequence: 3' ATTTCTACGCAGAATCTGACTTCAGCTCTTACATTGCA 5' mRNA= protein= 1. Transcribe this DNA strand into it's complementary mRNA strand. To make it easier, you may write the mRNA sequence directly below the DNA sequence above. 2. Then, use the chart on the next page to translate the mRNA into the protein fragment. II) The initial DNA sequence is typed below again. Insert a Thymine between the 8th and 9th base to mimic an insertion mutation. 3' ATTTCTACGCAGAATCTGACTTCAGCTCTTACATTGCA 5' mRNA= protein= What kind of mutation is this and what happened to the protein? 1. Transcribe the mutated DNA strand into it's complementary mRNA strand. 2. Then, use the chart on the next page to translate the mRNA into the protein fragment.
Bhavya L.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD