Using the DNA strand below, create an mRNA transcript and using that mRNA transcript create a protein. 3' G T T C T A C G A C G T T G C A A T A G C T T A A A T C G C C 5' What is the effect of having the second C turned to an A nucleotide? What type of mutation is this? What is the effect of changing the second T to an A? How would you describe this mutation? What is the effect of mutating the fourth T to a C and what type of mutation is this?
Added by Wendy B.
Close
Step 1
The given DNA strand is: 3' GTIcTCGA€GTIGCA4TAGCTIA44T€GC5' We can rewrite this by replacing the unknown characters (I, €, 4, 5) with standard nucleotides (A, C, G, T): 3' GTACTCGACGTAGCATAGCTACATTAGCT' Now, let's find the complementary mRNA strand. Remember Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 62 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Using the DNA strand below, create an mRNA transcript and use that mRNA transcript to create a protein. 3’ G T T C T A C G A C G T T G C A A T A G C T T A A A T C G C C 5’ What is the effect of having the second C turned into an A nucleotide? What type of mutation is this? What is the effect of changing the second T to an A? How would you describe this mutation? What is the effect of mutating the fourth T to a C and what type of mutation is this? Re-transcribe and retranslate the protein if an insertion of an A nucleotide were to occur after the second C. What type of mutation is this?
Madhur L.
Transcribe this segment of DNA (give the mRNA sequence) and then translate the mRNA (give the amino acid sequence of the polypeptide that will be produced). (How does a ribosome know where to start translating?) 3' CCGATACAGCCTAAACACTT 5' template strand 5' GGCTATGTCGGATTTGTGAA 3' coding strand mRNA: 5' amino acid sequence: b. Now change the bold nucleotides so that the A becomes a G and the T becomes a C. What kind of a mutation is this? i. frameshift ii. nonsense iii. missense iv. silent
Bryan V.
Using the information given, answer questions 1-3 below. A gene has undergone transcription to make mRNA with the following base sequence 5' AUG CGU UCA 3' (wildtype mRNA). let's say a mutation occurred in this gene. the mutated version of the gene then undergoes transcription to make mRNA with the following base sequence: 5' AUG CGA UCA 3' (mutant mRNA). question 1: what is the amino acid sequence of the protein specified by the unchanged/wildtype gene? question 2: based on the information above, what kind of mutation occurred (give the name/type of mutation) question 3: a nonsense mutation in the gene would most likely change/affect which codon in the mRNA (you can indicate 1st , 2nd, 3rd codon, etc or you can write the base sequence of the codon in the wildtype mRNA that would be affected by the mutation) Please number your answers so I know which question you are answering.
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD