Which one of the following is correct about cystic fibrosis (CF)? CF is a monogenic genetic mutation that affect exclusively the respiratory system. CFTR modulator therapies are targeted therapies designed to correct the malfunctioning protein made by the CFTR gene. CFTR mutation can be categorised into type I-VI based on the severity of the disease. Mutation type VI is the most severe. CF is a autosomal dominant genetic disorder, and the gene is mutation of CFTR gene, cystic fibrosis transmembrane regulatory protein.
Added by Julian M.
Close
Step 1
Statement 1: "CF is a monogenic genetic mutation that affect exclusively the respiratory system." - CF is indeed a monogenic genetic disorder, meaning it's caused by a mutation in a single gene (CFTR). - However, CF does *not* exclusively affect the respiratory Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 53 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Essay Title: Describe a genetic disorder that is caused by the mutation of a single gene
Adi S.
Cystic fibrosis is the most common fatal genetic disorder in humans. It is caused by recessive mutations in the CFTR gene, which encodes a membrane protein that regulates chloride ion transport. The mutations lead to partial or complete loss-of-function of the membrane protein. About 1 in 23 Caucasians carry a mutant allele. Given the devastating consequences of mutations in the CFTR gene, scientists have wondered why mutant alleles are not more rare. One hypothesis for why mutations are relatively frequent is that heterozygotes are more resistant to cholera. If this hypothesis is correct, then mutant alleles at the CFTR gene would show
Cystic fibrosis is a hereditary disorder that results in difficulty breathing due to thick mucus in the lungs and digestive troubles due to decreased enzyme production in the pancreas. It is most commonly caused by a mutation in the CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) gene. The following is the template strand for a region of the CFTR gene that contains the mutation. The wild type version of the DNA is the template strand in a healthy individual. The CF version is the template strand in a person with the disease. Wild type DNA 3’ – CTTTTATAGTAGAAACCACAAAGGATA – 5’ CF DNA 3’ – CTTTTATAGTAGCCACAAAGGATA – 5’ a. Transcribe and translate both of the above pieces of DNA. Be sure to label the ends of each macromolecule (i.e. DNA with the 3’ and 5’ ends, and peptide with the C terminus and N terminus). Note that this region is merely a section from the middle of the coding sequence and is in the correct reading frame. There are no introns in the provided sequence. b. What type of mutation is represented in this disease? What effect does it have on the primary structure of the protein? What effect might it have on the tertiary structure of the protein? Explain your responses. c. Sometimes mutations affect gene regulation without altering the protein sequence. Describe one hypothesized situation that meets this criterion.
Keemin L.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD