You are studying a eukaryotic gene in which translation...

You are studying a eukaryotic gene in which translation normally begins with the second AUG in the mRNA. The sequence surrounding the two AUG codons is: CGGAUGCACAGGACAUCCUAUGGAGAUGA where the two AUG codons are underlined. Predict the effects of the following mutations on translation of this mRNA. a. Changing the first and second C's to G's. b. Changing the first and second C's to G's, and also changing the UAU codon before the second AUG codon to UAG. c. Changing the GAGAUGA sequence at the end to CAGAUGU

You are studying a eukaryotic gene in which translation normally begins with the second AUG in the mRNA. The sequence surrounding the two AUG codons is:
CGGAUGCACAGGACAUCCUAUGGAGAUGA
where the two AUG codons are underlined. Predict the effects of the following mutations on translation of this mRNA.
a. Changing the first and second C's to G's.
b. Changing the first and second C's to G's, and also changing the UAU codon before the second AUG codon to UAG.
c. Changing the GAGAUGA sequence at the end to CAGAUGU

Key Concepts

Premature Stop Codon (Nonsense Mutation)

A premature stop codon results from a mutation that converts a coding codon into a termination signal, causing early termination of translation. This type of mutation can lead to the production of incomplete, and often nonfunctional, proteins and is a key factor in the study of mutation effects on gene expression.

Ribosomal Scanning Mechanism

This mechanism describes how the ribosome binds to the 5' end of an mRNA and moves along it until it encounters an AUG codon with a favorable context, as dictated by the Kozak sequence. It explains why, even with multiple AUG codons present, only one is typically used to initiate translation, based on the contextual signals and efficiency of recognition.

Mutational Analysis in Translation

Mutational analysis examines how specific changes in the nucleotide sequence, such as point mutations or insertions/deletions, affect the translation process. These mutations can alter the context surrounding start codons or modify other key sequence elements, leading to changes in initiation site selection, translation efficiency, or even the production of detrimental products like truncated proteins.

Eukaryotic Translation Initiation

This concept involves the process by which the ribosome assembles on the mRNA and identifies the correct start codon to begin protein synthesis. In eukaryotes, the small ribosomal subunit, along with initiation factors, binds to the 5' end of the mRNA and scans for an AUG codon in an appropriate sequence context before recruiting the large subunit to form the complete ribosome for translation.

Kozak Consensus Sequence

The Kozak sequence is a conserved nucleotide motif surrounding the start codon in eukaryotic mRNAs that is critical for the efficient recognition of the initiation site by the ribosome. Variations in this sequence can enhance or diminish translation initiation depending on how closely they match the optimal consensus, thus influencing which AUG is selected as the starting point for translation.

Transcript

Please give Ace some feedback