Molecular Biology

Robert F. Weaver

Chapter 17 The Mechanism of Translation I: Initiation - all with Video Answers

Educators

Chapter Questions

Problem 1

Describe and give the results of an experiment that shows that ribosomes dissociate and reassociate.

Check back soon!

View

Describe a toeprint assay involving E. coli ribosomal subunits and a fictious mRNA in a cell-free extract that contains all the factors necessary for translation. What results would you expect to see with $30 \mathrm{~S}$ ribosomal subunits alone? With $50 \mathrm{~S}$ subunits alone? With both subunits and all amino acids except leucine, which is required in the $20^{\text {th }}$ position of the polypeptide?

Rashmi Sinha

Numerade Educator

00:41

Problem 2

How does IF3 participate in ribosome dissociation?

Sam Limsuwannarot

Numerade Educator

05:29

Problem 2

Predict the effects of the following mutations on phage R17 coat gene and replicase gene translation:
a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon.
b. Mutations in the stem loop around the coat gene initiation codon that weaken the base-pairing in the stem loop.
c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.

Eric Goldman

Numerade Educator

04:52

Problem 3

What are the two bacterial methionyl-tRNAs called? What are their roles?

Pronoy Sinha

Numerade Educator

02:43

Problem 3

You are studying a eukaryotic gene in which translation normally begins with the second AUG in the mRNA. The sequence surrounding the two AUG codons is:
CGGAUGCACAGGACAUCCUAUGGAGAUGA
where the two AUG codons are underlined. Predict the effects of the following mutations on translation of this mRNA.
a. Changing the first and second C's to G's.
b. Changing the first and second C's to G's, and also changing the UAU codon before the second AUG codon to UAG.
c. Changing the GAGAUGA sequence at the end to CAGAUGU

Mystique Till

Numerade Educator

00:45

Problem 4

You are studying a eukaryotic mRNA that you believe exhibits control at the level of translation, particularly the initiation of translation. You think that the 5'-UTR plays a role in the control of translation. To definitively determine the role of the 5 '-UTR, describe in detail experiments that you could perform to prove this. Be sure to include how you would experimentally determine if a protein binds to the $5^{\prime}$-UTR to prevent translation and the possible effects a mutation in the 5 -UTR might have on gene expression at the RNA level.

Sam Limsuwannarot

Numerade Educator

01:27

Problem 4

Why does translation of the MS2 phage replicase cistron depend on translation of the coat cistron?

Jessica Wooten

Numerade Educator

02:53

Problem 5

Present data (exact base sequences are not necessary) to support the importance of base-pairing between the ShineDalgarno sequence and the $16 \mathrm{~S} r \mathrm{rNA}$ in translation initiation. Select the most convincing data.

John Barone

Numerade Educator

Problem 6

Present data to show the effects of the three initiation factors in mRNA-ribosome binding.

Check back soon!

Problem 7

Describe and give the results of an experiment that shows the role (if any) of GTP hydrolysis in forming the 30 S initiation complex.

Check back soon!

Problem 8

Describe and give the results of an experiment that shows the role of GTP hydrolysis in release of IF2 from the ribosome.

Check back soon!

01:15

Problem 9

Present data to show the effects of the three initiation factors in fMet-tRNA ${ }_f^{\text {Met }}$ binding to the ribosome.

Sam Limsuwannarot

Numerade Educator

Problem 10

Draw a diagram to summarize the initiation process in E. coli.

Check back soon!

00:24

Problem 11

Explain what the Shine-Dalgarno sequence and the Kozak consensus sequence are and compare and contrast their roles.

Sam Limsuwannarot

Numerade Educator

01:27

Problem 12

Write the sequence of an ideal eukaryotic translation initiation site. Aside from the AUG, what are the most important positions?

Lottie Adams

Numerade Educator

06:08

Problem 13

Draw a diagram of the scanning model of translation initiation.

Bryan Lynn

Numerade Educator

00:41

Problem 14

Present evidence that a scanning ribosome can bypass an AUG and initiate at a downstream AUG.

Sam Limsuwannarot

Numerade Educator

00:41

Problem 15

Under what circumstances is an upstream AUG in good context not a barrier to initiation at a downstream AUG? Present evidence.

Sam Limsuwannarot

Numerade Educator

Problem 16

Describe and give the results of an experiment that shows the effects of secondary structure in an mRNA leader on scanning.

Check back soon!

02:50

Problem 17

Draw a diagram of the steps in translation initiation in eukaryotes, showing the effects of each class of initiation factor.

Khalida Dawar

Numerade Educator

Problem 18

Describe and give the results of an experiment that identified the cap-binding protein.

Check back soon!

Problem 19

Describe and give the results of an experiment that shows that cap-binding protein stimulates translation of capped, but not uncapped, mRNAs.

Check back soon!

01:33

Problem 20

What is the subunit structure of elF4F? Molecular masses are not required.

Madi Sousa

Numerade Educator

Problem 21

Describe and give the results of an experiment that shows the roles of eIF4A and eIF4B in translation.

Check back soon!

00:36

Problem 22

How does the poliovirus genetic material resemble a typical cellular mRNA? How it is different? How does the virus take advantage of this difference? Compare and contrast this behavior with that of the hepatitis $C$ virus.

Sam Limsuwannarot

Numerade Educator

02:24

Problem 23

How do we know that eIF1 and eIF1A do not cause conversion of complex I to complex II by stimulating scanning on the same mRNA?

Sana Riaz

Numerade Educator

02:52

Problem 24

Compare the initiation factors IF2 and eIF5B. What functions do they have in common? What function can IF2 perform that eIF5B cannot? What factor performs this function in eukaryotes?

Joanna Quigley

Numerade Educator

05:41

Problem 25

Describe the mechanism by which the $r p o H$ mRNA senses high temperature and turns on its own translation. What is the evidence for this model?

Sana Riaz

Numerade Educator

04:27

Problem 26

Describe the mechanism by which the riboswitch in the E. coli thiM gene controls translation.

Jennifer Stoner

Numerade Educator

Problem 27

Present a model for repression of translation by phosphorylation of eIF2 $\alpha$.

Check back soon!

Problem 28

Present a model to explain the effect of 4E-BP1 phosphorylation on translation efficiency.

Check back soon!

Problem 29

Describe and give the results of an experiment that shows the importance of the IRE in the ferritin mRNA to iron inducibility of ferritin production.

Check back soon!

03:58

Problem 30

Present a hypothesis for iron inducibility of ferritin production in mammalian cells. Make sure your hypothesis explains why ferritin production is not inducible in cells in which the ferritin gene is driven by a strong promoter.

Danielle Ashley

Numerade Educator

00:22

Problem 31

How is the human let-7 miRNA thought to control expression of its target genes? Summarize the evidence for this model.

Joanna Quigley

Numerade Educator