2 1 point DNA fingerprinting is possible because of changes or variations in:
Added by Daniela B.
Close
Step 1
The technique relies on variations in DNA sequences between individuals. Show more…
Show all steps
Your feedback will help us improve your experience
Marisa A and 51 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Marisa A.
1. Process of analyzing DNA variations for the purpose of identification is known as Genetic fingerprinting. B. DNA profiling C. DNA translating D. Both A & B are correct 2. What is meant by "noncoding" DNA? DNA that is not transcribed and translated into a protein. RNA that is not transcribed into DNA. There are no start and stop codons. DNA that requires a computer to translate. 3. What are repeated units of noncoding DNA called? Flanking regions B. Caps and Tails C. Short Tandem Repeats D. Codon and Anticodons CCACACAGGTAATGAATGAATGAATGAATGCCTAAGTGCC 4. From the above sequence determine the number of STR repeats of [GAAT]. Four B. Three C. Two D. Five 5. If a mother has 10,10 while the father has 12,14 and the daughter has 10,12, what term would describe the daughter's STR numbers? Homozygous B. Heterozygous C. Omnizygous D. Recessive 6. A technique for separating DNA fragments by size (molecular weight) is PCR B. STR C. Electrophoresis D. Doppler apparatus 7. Process where the amount of DNA can be amplified is known as Photophoresis B. PCR C. DNA profiling D. Electrophoresis 8. What does using DNA Forensics to compare a suspect's DNA with the crime scene DNA tell you? If the suspect is guilty B. If the suspect is insane C. If the suspect was at the crime scene D. All of these are correct 9. What does [GATA]7 mean? No repeating STR unit Seven repeating STR units Twenty-eight base units Both B and C are correct 10. What is the probability that another person has the same DNA profile as yours? 1 out of 2 B. 1 out of 100 C. 1 in 10 trillion D. 1 in 10,000
Sri K.
Below is an illustration of the 20 locations (loci) that are investigated for the number of repeating sequences (STRs) when creating a DNA profile for an individual. When looking at the TPOX locus on chromosome #2, the sequence that is found in everyone is AATG. The number of repeats found in both #2 chromosomes in the mother are 4, 6. The number of repeats found in both #2 chromosomes in the father are 7, 4. a) So, everyone on earth has the AATG sequence at the TPOX locus on chromosome #2, but what is the difference between one person and the next? b) Provide three examples of repeat sequences that could be found in the son or daughter? c) Are these repeats found in coding or noncoding regions of DNA? d) What is one basic difference between coding and noncoding regions of DNA? D3S1358 D2S441 TH01 D12S391 D8S1179 VWA D1S1656 D13S317 D2S1338 D7S820 D10S1248 10 11 12 13 D16S539 D18S51 D21S11 D19S433 D22S1045 14 15 16 17 18 19 20 21 22
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD