a) 1) Usted es un criador de perros que desea obtener una nueva raza. Luego de varias generaciones usted ha logrado purificar una raza con valor comercial. Esta posee un gen letal (f) recesivo que se expresa cuando el animal es adulto y que puede inhibir el color del pelo. El color marrón del pelo es dominante mientras que el gris es recesivo. Como saldrán los descendientes de un cruce con un perro macho albino homocigoto recesivo para el color del pelo y homocigoto recesivo para el gene letal con una perra marrón homocigoto dominante para color del pelo y el gene letal en su forma dominante homocigoto. Realice el cuadrado de Punnet y líneas bifurcadas y determine la razón fenotípica y genotípica de la F1 y F2. (10 pts) b) Usted es dueño de un jardín comercial y quiere producir rosas de varios colores. El color en las plantas se hereda por dominancia incompleta siendo el color azul el dominante y el amarillo el recesivo. Existe un gen epistásico recesivo (t) que produce plantas sin pigmentación en las flores. Si cruza dos plantas una con pigmentación azul en las flores y el gen epistásico dominante (ambas homocigotas) y otra con el genotipo recesivo de color pero albina y el gen epistásico recesivo (ambas homocigóticas). ¿Cómo será el genotipo de los padres? ¿Cómo será el genotipo y el fenotipo de la F1? Si cruza dos plantas de su F1, ¿cómo será la razón fenotípica y genotípica de la F2?. (5 pts). Resuelva el ejercicio con el cuadrado de Punnet y con líneas bifurcadas. (10 pts) 3) De acuerdo con los siguientes datos en este cruce dihíbrido determine como se hereda la característica (dominancia completa, dominancia incompleta ó epistasis). Muestre sus cálculos para demostrar como llego a sus conclusiones. Identifique que características son dominantes y cuales son recesivas (10 pts). Fenotipo | Individuos observados Árbol rojo con espinas | 49 Arbol rojo sin espinas | 144 Árbol blanco sin espinas | 447 Arbol blanco con espinas | 151 Total | 791
Added by Lourdes R.
Close
Step 1
First, we need to understand the given information about the dog breeding problem. We have a male dog that is homozygous dominant for brown hair color (BB) and homozygous recessive for the lethal gene (00). We also have a female dog that is homozygous recessive Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 77 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Sri K.
ACTIVITY 1.4 PEDIGREE ANALYSIS AND PROTEIN SYNTHESIS In humans, albinism is a recessive trait. The disorder causes a lack of pigment in the skin and hair, making an albino appear very pale with white hair and pale blue eyes. This disorder also occurs in animals, a common albino found in a laboratory is the white rat. The pedigrees below trace the inheritance of the allele that causes albinism. In each pedigree, a male is represented by a square and a female is represented by a circle. If the shape is shaded, that indicates that the individual displays the trait being studied. In the case below, shaded circles represent individuals who are albino (aa). 1. Given the following genotypes, describe the phenotypes (normal or albino) AA = Aa = aa = Fill in the blanks on the pedigree on the right. How many children does this family have? What are the sexes of the children? 2. Fill out the blanks of the pedigree: (AA, Aa, or aa) How many children did the original couple have? How many grandchildren do they have? 3. You are a Geneticist working in a laboratory when a doctor came and handed you an extracted human insulin. You were able to decode the DNA sequence of the sample and so below is a section of the human insulin sequence located in Row A. In Row B, give the complimentary base pair of the sequence and transcribe the DNA strand into mRNA in Row C, then, translate that strand into a polypeptide chain, identifying the codons in Row D, the anti-codons in Row E and the amino acid sequence in Row F. Use the Translation table provided as your reference. Don't forget to give the directionality of all the sequence. (10 pts) Row A: 5' GCGTATAATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTA 3'
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD