Gene Expression refers to the presence of functional gene product in the cell. Pick out the odd one that could NOT alter the levels of this functional gene product post-translation? Poly-A tail of mRNA ubiquitination followed by proteosomal degradation chemical modification of the protein e.g. phosphorylation or dephosphorylation Lack of chaperones that properly fold the proteins QUESTION 18 The binding of iron regulatory protein (IRP) to the iron response element (IRE) in the 5'UTR of the ferritin mRNA causes increases Ferritin (protein) synthesis in the cell decreases Ferritin (protein) synthesis in the cell has no effect on Ferritin (protein) levels in the cell QUESTION 19 What is Not true about transcriptional Silencer and Enhancer elements? are orientation independent can be upstream or downstream of the promoter region can be present in an intron sequence of the gene directly bind RNA polymerase
Added by Sabrina H.
Close
Step 1
Poly-A tail of mRNA: This is involved in mRNA stability and translation efficiency, so it can affect the levels of functional gene product. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 71 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Gene expression is complex, requiring many macromolecules and events. This means....lots of vocabulary terms! Complete this matching to show me your mastery of the new terminology. NOTE: Not all terms will be used. molecule that serves as a template for mRNA synthesis name of the process by which RNA is made name of the enzyme that makes RNA where transcription occurs in prokaryotes where transcription happens in eukaryotes where RNA polymerase binds on DNA to begin transcription molecule that serves as a template for protein synthesis structure responsible for assembling a protein where ribosomes bind to begin translation process of making a protein using mRNA triplet in mRNA coding for a specific amino acid, start or stop signal triplet on tRNA complementary to the triplet on mRNA A. cytosol B. translation C. nucleus D. ribosome E. promoter F. RNA polymerase G. rRNA H. transcription I. DNA J. anticodon K. codon L. replication M. with the first 3 nucleotides at the 5' end N. first AUG from the 5' end of mRNA O. mRNA
Mystique T.
Gene Expression Activity Changes in base pairs of DNA can dramatically alter the protein structure that is expressed through the process of gene expression. Beta hemoglobin with a change in a single base pair will result in a cell expressing a gene for Sickle Cell Anemia. https://www.biointeractive.org/classroom-resources/sickle-cell-disease 7. What do we call an uncorrected mistake in DNA? 8. What are two processes that are used to correct these mistakes? The following gene sequence is the first portion of the DNA sequence for normal beta hemoglobin. TACCACGTGGACTGAGGACTCCTCTTCAGA 9. Using this DNA sequence, transcribe the nucleotide sequence into the corresponding mRNA sequence. After transcription, we use the codons to translate the mRNA sequence into a chain of amino acids using the table below. 10. Please take your transcribed mRNA sequence and translate it into an amino acid chain. The following gene sequence is the first portion of the DNA sequence for Sickle Cell beta hemoglobin. TACCACGTGGACTGAGGACACCTCTTCAGA 11. Using this DNA sequence, transcribe the nucleotide sequence into the corresponding mRNA sequence. 12. Please take your transcribed mRNA sequence and translate it into an amino acid chain.
Jackson M.
80. Gene expression is an integral part of molecular biology. Answer the next five questions about DNA and gene regulation. (15 points total) A. DNA transcription is the process by which mRNA is formed from certain genes. Draw out a eukaryotic mRNA strand. Be sure to include all of the different components that are found on an mRNA. The message should be at least 15 nucleotides long. (6 points) B. This message will then be translated into amino acids. Draw out the general structure of an amino acid. Label it carefully. (4 points) C. These amino acids will be incorporated together and linked with what type of bond? (1 point) D. The resulting protein can then be packaged in vesicles and sent to the location it is needed. Your protein is going to be sent to the plasma membrane. What are the properties (what does it consists of) that are unique to the plasma membrane? (2 points)
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD