Having two very large open reading frames is quite unusual. Perhaps this is due to the composition of the DNA sequence. Obtain just the coding region from the DNA record, GenBank accession number EF595246. Using the DNA Stats program from the Sequence Manipulation Suite, determine the base composition of the correct open reading frame, and based on the results propose a reason for the presence of two large reading frames.
Added by Lisa V.
Step 1
Step 1: Access the GenBank record for EF595246 and locate the coding region of the DNA sequence. Show more…
Show all steps
Your feedback will help us improve your experience
Keemin Lee and 97 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
You have isolated a protein that you think is encoded within a small region of DNA. In this region there are 3 open reading frames (ORFs). Open reading frames are DNA sequences that are likely genes (have typical promoters, start and stop codons). ORF #1 has an open reading frame of 1500 nucleotides (AUG to stop codon) ORF #2 has an open reading frame of 600 nucleotides ORF #3 has an open reading frame of 900 nucleotides The protein you isolated is 33kDa in size. If the average amino acid mass is 110 Da, then which of the above 3 ORFs most likely codes for this protein?
Keemin L.
Open reading frames are regions of DNA that encode at least one AUG start codon and have a long stretch of codons specifying amino acids before any stop codons (UAA, UGA, UAG) are encountered. Recall that a segment of double-stranded DNA has six possible reading frames, three in the top strand and three in the bottom strand. Consider the double-stranded DNA sequence below: 5' CAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAATCCGAG 3' 3' GTTACCGATCCATGATACATACTCTAGTACTAGAAATGTTTAGGCTC 5' (a) (6 pts) Convert the three reading frames of the top strand into RNA sequences by choosing in turn, the first, second, and third nucleotides as the first base in a codon. Write the RNA sequences in the 5' --> 3' direction with a space between each codon. Underline the start codons and double underline the stop codons. Number the reading frames as 1, 2, and 3. Reading frame 1 starts with the first nucleotide, reading frame 2 starts with the second nucleotide, and reading frame 3 starts with the third nucleotide in each strand. (b) (4 pts) You are trying to identify the gene for a large protein (with many amino acids). Could any of these reading frames encode this protein? Can you eliminate any of the possible reading frames above from coding for this protein? If so, which one(s) and why?
Supreeta N.
You have isolated a protein that you think is encoded within a small region of DNA. In this region, there are 3 open reading frames (ORFs). Open reading frames are DNA sequences that are likely genes (have typical promoters, start and stop codons). ORF #1 has an open reading frame of 1500 nucleotides (AUG to stop codon). ORF #2 has an open reading frame of 600 nucleotides. ORF #3 has an open reading frame of 900 nucleotides. The protein you isolated is 33 kDa in size. If the average amino acid mass is 110 Da, then which of the above 3 ORFs most likely codes for this protein? a) ORF #1 b) ORF #2 c) ORF #3 d) None of the ORFs are large enough to encode this protein
Josee P.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD