Q1. Please outline FOUR methods that would allow you to identify an enhancer element for a putative oncogene you discovered using a prostate cancer cell line model. Include at least one method that is genomic-scale. Briefly describe how the method works. Q2. You just started a rotation in a virology lab and have been assigned to analyze a human blood sample, which had been infected by a new virus. In addition to other phenotypes your lab has observed, you discovered that RNA molecules and particularly polyA-containing RNAs are retained in the nucleus at 10 times the level compared to a control blood sample. You suspected that a viral protein might be interfering with the nuclear dynamics of the cells and after some investigation, you determined that the virus is overproducing a protein called JUST MAKING UP A NAME. Please generate AT LEAST TWO HYPOTHESES of the function of JUSTMAKINGUPANAME pertaining to the said phenotype. Then outline the experimental design (approach) for testing such a hypothesis and the expected results if your hypothesis were true.
Added by Belinda C.
Close
Step 1
Methods to identify an enhancer element for a putative oncogene in a prostate cancer cell line model: Show more…
Show all steps
Your feedback will help us improve your experience
Jenny Wu and 80 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
As a senior molecular geneticist, you have found a new protein found in the kidney, and have determined its genetic sequence. That protein is an enzyme that functions in repairing cellular damage caused by toxins. You have developed a simple method to test the presence and activity of this enzyme. You need to know: A. What is its gene sequence? B. Where is it made? C. Do other organisms make this protein? D. Are the sequences from other organisms similar? E. Is it always made or only at certain times? F. How is the gene regulated? What do studies of identical twins reveal about epigenetic variations? When histone deacetylase proteins are recruited to a genetic locus, what events are likely to happen? Conduct a research on stem cell application on treating COVID-19 and submit your answers based on the steps introduced by the UAE scientists in isolating, designing protocols and implementing the treatment procedures to treat the COVID-19 in the UAE patients who have shown serious respiratory inflammations. Explain how the methylation of tumor suppressor genes can lead to cancer?
Sri K.
You are studying an oncogene in humans and have isolated an mRNA that is expressed only in cancer cells. You have generated a cDNA from this mRNA using Reverse Transcriptase which you can then amplify using PCR for standard DNA sequencing. The sequence of the PCR product that you generated is shown below. Both strands are shown. 5'-AGCCACCATGGCGGATGAATTACCCGCATTGGCCATACCTAAATCCTAGAAAAAAAA 3'-TCGGTGGTACCGCCTACTTTAATGGGCGTAACCGGTATGGATTTAGGATCTTTTTTTT Now that you know the sequence, you are planning to genetically engineer E. coli cells to produce the abnormal polypeptide encoded by this oncogene mRNA so you can study its molecular function and possibly develop a drug treatment for this type of cancer. In order to have E. coli express the protein, you need to PCR amplify ONLY the open reading frame (ORF) so you can insert it into a vector with the proper E. coli signals for expression (e.g. Pribnow box, Shine-Dalgarno sequence, bacterial terminator etc). What primer sequences do you need to amplify just the open reading frame on this cDNA? Mutations in the BRCA (breast cancer susceptibility protein) genes are known to cause heritable susceptibility to breast cancer. On the molecular level, the BRCA proteins are involved in the repair of DNA double strand breaks. When patients carrying a recessive mutation in the gene are losing the function of the second allele due to another mutation, the resulting tumor cells will rapidly accumulate additional mutations. What type of mutagen would be the most detrimental to the DNA in this type of "BRCA knockout" tumor? Select one: Chemicals that cause base substitutions All mutagens would be equally detrimental Chemicals that intercalate into the DNA and cause frameshifts Non-ionizing radiation, such as UV radiation Ionizing radiation, such as X-rays or gamma radiation Mutations in the CF gene cause the genetic disorder cystic fibrosis in humans. Researchers have found that the normal gene encodes a protein that functions in the transport of chloride ions across the cell membrane and that the protein from the mutated gene doesn't transport chloride ions very well. What is this research an example of? Select one: a. Transmission genetics b. Conservation genetics c. Population genetics d. Evolutionary genetics e. Molecular genetics
A friend of yours who works at a biotechnology start up company has computationally designed three new proteins that she thinks might be able to prevent and possibly reverse cancers if they could be expressed in the right place in cells. If this works, the company will be worth billions and everyone who works there will be rich. The plan is to use a genetically modified virus to deliver the DNA genes for these three proteins. This should result in the transcription of mRNA and translation of the three proteins. The trick is getting the proteins to go to the right places in the cells so they can interact with the right cellular pathways. One protein is a transcription factor that binds to DNA and should shuts down transcription of cancer promoting genes by binding to their promoters. The second is a protein that interacts with electron transport chain proteins to reduce the output of reactive free radicals in mitochondria. The third is a cell surface protein that inhibits incoming growth factor signals. Based on your talents in cell biology, your friend offers you a job on her research and development team. Your goal is to genetically modify each of these designer proteins so that when they are transcribed and translated in a human cell, they will be transported by cellular machinery to the correct location in the cell for their specific functions. How would you do this? Give a description of what you would add to each of the three proteins to get them transported to the right place and how the relevant transport system works.
Dominador T.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD