You are given a 50 bp DNA with the following sequence: 5’ GTCAGCGTTAGAATTCAGGAGTGCTCTGAGCTGGAATTCGACAACTCCTA 3’ Predict the numbers and sizes of DNA fragments produced if the DNA was digested with the following restriction enzymes: 1. EcoRI 2. AluI 3. A mixture of EcoRI and AluI Question 3: The resulting restriction fragments from Question 2 were subjected to agarose gel electrophoresis. Draw the expected electrophoretic image. Consider each nucleotide to have the same weight. Question 4: How many DNA fragments would you expect if the above DNA was circular and digested with AluI? Question 5: If a researcher began with a sample that contained three copies of double-stranded DNA, how many copies would be present after 27 cycles of PCR if PCR was 80% efficient?
Added by Jeanne S.
Step 1
Question 2: Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 96 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
You have a 120 bp linear DNA molecule available, with the sequence provided below. Assume this DNA molecule is digested with HaeIII and AgeI simultaneously. How many DNA fragments, and of what sizes, do you expect after digestion? Motivate. 5’ CGCTCAGTACTTTATTTTGGCCTTCCTCTTCATGATCGCTTTCGTGATCGTCTTATAATGTGTGGATGTAGCCTAAGCGGGCTTTCTGCAGGAGTGGCAACCGGTTTACGGACGTCCCCG 3’ e) You prepare an agarose gel, and in the first well you load a DNA size marker containing fragments of 20 bp, 50 bp, 100 bp, and 150 bp. In wells 2 and 3, you load the undigested DNA molecule shown in (d) above, and the products of the HaeIII/AgeI double digestion, respectively. Following electrophoretic separation of the fragments, the gel is transferred to a membrane, and hybridized to a radioactively labeled 20 bp probe, which anneals to bases 40-60 of the original linear DNA molecule. Draw the gel and blot profiles you expect to observe. f) Is the blot described in (e) above a Southern, Northern, or Western blot? Motivate your answer.
Jenny W.
Consider the following DNA molecule 5’ CCGGGGCCAATTGGCCGTACCGAATTGGCCGAATTCCGGCCTTGGCCTACGGGCTCGGGCCGC 3’ 3’ GGCCCCGGTTAACCGGCATGGCTTAACCGGCTTAAGGCCGGAACCGGATGCCCGAGCCCGGCG 5’ How many base pairs (bp) is the original fragment? (1 point) ___ The enzyme HaeIII has the following restriction site 5’ GGvCC 3’ 3’ CC^GG 5’ (‘v’ and ‘^’ indicates the specific bond that is digested) If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) ___ If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point) ___ 2. Using the results from question #1 (for entire sequence and linear DNA), draw the results on a gel( ‘—’ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)
Madhur L.
BELOW IS A SEGMENT OF DNA, WHICH WILL BE CUT WITH VARIOUS RESTRICTION ENZYMES CCATTCGATGAATTCTACGGATCCTTACTAAGCTTGGCGCCCCAGGATCCATTCGACCTA GGTAAGCTACTTAAGATGCCTAGGAATGATTCGAACCGCGGGGTCCTAGGTAAGCTGGAT
Sarah C.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD