2. The DNA sequencing gel at right shows Sanger sequencing of part of the protein-coding region of the human CFTR gene; a mutated allele of this gene is responsible for the disorder cystic fibrosis (CF). The sequence on the left is from a normal individual; the sequence on the right is from someone who is homozygous for a CF allele. Note the letters at the top of each lane; each indicates the ddNTP that was included in the sequencing reaction for that lane of the gel. What are the first 15 bases of the normal DNA sequence? (Indicate 5’ and 3’ ends of the sequence.) [4 pts] CTAG CTAG What is different in the mutant allele? [2 pts] Please be as specific as you can. normal CF Assuming the first three bases of your sequence encode an in-frame codon, what effect will the mutation have on the CFTR protein encoded by the gene? [2 pts]
Added by Emily H.
Close
Step 1
First, we need to read the DNA sequence from the normal individual. We can do this by reading the gel from bottom to top and noting the base at each position. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 78 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Refer to the following template DNA strand to answer the following questions: 3'-TTCCCGGGATAACGATGT-5'. What would be the sequence of the complementary DNA strand that would bind to this strand of DNA double helix? Note: Label the 3' and 5' ends. What is the sequence of the mRNA strand that corresponds with the template DNA strand? Note: Label the 3' and 5' ends. What is the sequence of amino acids directed by mRNA? Note: Label the N-terminus and the C-terminus. Mutations are changes in the base pair sequence in DNA. What would be the resulting polypeptide if the template DNA strand shown above mutates to the following: 3'-TTCCCGGGATTTCG-5'? Why is ATC not listed as one of the codon sequences?
Jackson M.
2. The DNA below shows the sequence of a template strand on top (with the ends labeled) and a sequencing primer on the bottom (with the ends not labeled, but shown correctly aligned with the template). 5' - AGTCGGATGTTGTACTGCATGGTACAATAGCATAAGCTGGAGTTTCTTATTCGATGCG - 3' CCATGTTATCGTATTCGA Assume that you have run a set of conventional Sanger dideoxy sequencing reactions using this combination of template and primer. You then run a denaturing polyacrylamide gel to analyze the four sequencing reactions and determine the sequence. Using the DNA sequences shown above, draw the sequencing gel results as you would expect it to appear at the end of electrophoresis. G A T C
Adi S.
To the left is a drawing of the results of DNA gel electrophoresis. Three DNA were analyzed: Lane 2 is DNA from a woman with the BRCA1 cancer-causing RFLP mutation, while Lane 3 and Lane 4 are the results from her children. a) Based on these results, which child (Lane 3 or 4) also has the BRCA1 mutation and why? (1 pt) b) Which bands in the picture are the smallest: the ones closest to the wells or farthest away? (1 pt) 10) The restriction enzyme EcoRI detects the DNA sequence GAATTC and cuts between the G and A (read from left to right). a) (1pt) Indicate with a line where this restriction enzyme would cut the following DNA sequence: GTCGTCGGCACCGATGAATTCGCTGACGAATTCATACACGCTTAATACCATGGGCTT b) (1 pts) After being cut by the restriction enzyme, the DNA sequence above was put through gel electrophoresis. This DNA sequence could belong to which individual(s) from the gel electrophoresis drawing in Question #9? Why?
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD