Which statement about regulation of translation is correct? Translation initiation complexes recognize and bind to the \( 5^{\prime} \) cap. The translation initiation complex scans for a TAC codon near the \( 5^{\prime} \) cap. The 5' UTR sequence does not affect the efficiency of translation initiation. One of the key variables for influencing efficient translation is the sequence of nucleotides flanking the first GUG codon. Regulation of translation does not depend on sequences in the \( 3^{\prime} \) UTR or the poly(A) tail.
Added by Teresa M.
Close
Step 1
The \( 5^{\prime} \) cap is crucial for the initiation of translation as it is recognized and bound by the translation initiation complex. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
How does the eukaryotic translation initiation complex locate the correct start codon? A. The General Transcription Factors locate the promoter, then help RNA polymerase enter the complex to form the preinitiation complex. B. The initiation complex moves the small ribosomal subunit through the 5' UTR, scanning for the Kozak sequence 5' ACCAUG-3'. C. The true start codon is the first ATG encountered downstream of the Shine-Dalgarno sequence. D. The pre-initiation complex moves the ribosome through the 3' UTR, scanning for the Kozak sequence.
Sri K.
The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT 5’ 5’ ACTTCGTATAATCATGGCTACAGCTTCGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand (top/bottom) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don't forget that there is always some 5' untranslated region encoded in the mRNA. Give the N and C ends of the protein.
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD