Based on the mRNA sequence of "Gene X," the N- and C-termini of the translated protein product should each contain a stretch of hydrophobic amino acid residues. Protein sequencing techniques identify a mature protein that is identical to the predicted protein except that the hydrophobic stretches in the N- and C-termini are missing. (9 marks total) (A) Explain the function and fate of the N-terminal hydrophobic region. (3 marks) (B) Explain the function and fate of the C-terminal hydrophobic region. (3 marks) (C) Which subcellular compartment do you expect to find the mature protein product of Gene Y? Explain your answer. (3 marks)
Added by Elisa R.
Close
Step 1
Signal peptides are short sequences of amino acids that target proteins to specific subcellular compartments, such as the endoplasmic reticulum (ER) or the mitochondria. In this case, the hydrophobic region acts as a signal peptide that directs the protein to the Show more…
Show all steps
Your feedback will help us improve your experience
Shveta Prithiani and 72 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following DNA strand is a template strand of a prokaryotic gene. Transcription start site is indicated by a bold "G". a) Underline the promoter region of this gene by a dotted line. b) Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box? c) Deduce the nucleotide sequence of mRNA for this gene. d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino acids does this mRNA code for? What is the sequence of the codons in this mRNA? e) Show 5' and 3' ends of the template strand and mRNA. f) What are the -10 and +10 base pairs of this gene? CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
Adi S.
Determine the protein's amino acid sequence that would be produced by expression of this segment of DNA shown below (sense strand). Use the information below to find the gene signal and translate the bases into mRNA and then protein. Determine which ATG/AUG to use by finding one that is downstream of the Shine-Dalgarno sequence. What is that? Read on. The Shine-Dalgarno (SD) sequence is a ribosomal binding site in prokaryotic messenger RNA, roughly located around 8 bases upstream of the start codon AUG. The RNA sequence helps recruit the ribosome to the messenger RNA (mRNA) to initiate protein synthesis by aligning the ribosome with the start codon. The Shine-Dalgarno sequence exists both in bacteria and archaea. It is also present in some chloroplast and mitochondrial transcripts. The six-base consensus sequence of the Shine-Dalgarno is AGGAGG. Sense strand of DNA: 5'-ATGTTATAAGTGGAAAGGAGGGGTTATGCCTTGAAAATGTCATAGTCCGTACGT-3' A) Met – Leu B) Met – Pro C) Met – Ser
Madhur L.
2. Explain how mRNA and tRNA work together to get amino acids into their correct places in the protein. (3 marks) 3. Explain the significant of start codons and stop codons in translation. (3 marks) 4. Explain the elongation of translation in prokaryotic cell. (5 marks) 5. Regulation of gene expression can take place at multiple stages in eukaryotic cell. Briefly explain gene regulation in transcription level in eukaryotic cell. (4 marks) 6. What are the places of gene expression for prokaryotic and eukaryotic? Why eukaryotic gene expression is more complicated than in prokaryotes? (3 marks) 7. Explain gene regulation in post translation level in eukaryotic cell. (4 marks)
Dominador T.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD