Given an original mRNA sequence of: CCU ACA GUA UGC AGG ACG What is the effect of a mutation where the new mRNA sequence is (the mutation is in bold): CCU ACA GUA UGA AGG ACG Use the mRNA codon chart below to help answer the question U C A G UUU = phe UCU = ser UAU = tyr UGU = cys UUC = phe UCC = ser UAC = tyr UGC = cys UUA = leu UCA = ser UAA = stop UGA = stop UUG = leu UCG = ser UAG = stop UGG = trp CUU = leu CCU = pro CAU = his CGU = arg CUC = leu CCC = pro CAC = his CGC = arg CUA = leu CCA = pro CAA = gln CGA = arg CUG = leu CCG = pro CAG = gln CGG = arg AUU = ile ACU = thr AAU = asn AGU = ser AUC = ile ACC = thr AAC = asn AGC = ser AUA = ile ACA = thr AAA = lys AGA = arg AUG = met ACG = thr AAG = lys AGG = arg GUU = val GCU = ala GAU = asp GGU = gly GUC = val GCC = ala GAC = asp GGC = gly GUA = val GCA = ala GAA = glu GGA = gly GUG = val GCG = ala GAG = glu GGG = gly frameshift silent missense nonsense
Added by Ifeoma R.
Close
Step 1
** Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 51 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Consider the CODING sequence below: What would be the corresponding mRNA sequence? Using the genetic code table, determine the corresponding Amino Acid sequence. If the red C was DELETED, what kind of mutation would that cause (missense/nonsense/frameshift)? What would be the resulting effect on the translated peptide? The Genetic Code Second base in codon UUU Phe UUC Phe UUA Leu UUG Leu CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG Met GUU Val GUC Val GUA Val GUG Val UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu UGU Cys UGC Cys UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly Coding Sequence: ATG TTC CAC ACG CTG ATA CCA GCT
Farhan A.
mRNA: polypeptide Gln-STOP-Asn-Ala-Phe-Asn-STOP 2. In the wt DNA strand shown in the previous problem, what would be the effect on the resulting polypeptide if T is mutated to A at base 6? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = GTT ACA TTG CGG AAA TTG ACT mRNA = CAA UGU AAC GCC UUU AAC UGA Polypeptide = GLN-CYS-ASN-ALA-PHE-ASN-STOP 3. What would be the effect on the polypeptide if T is mutated to C at base 17 on the wt DNA? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = GTTACTTTGCGGAAATCGACT mRNA = 5' CAA UGA AACCCC UUVA GOUGA 3' Polypeptide = gln-stop-asn-ala-phe-ser-stop 4. What would be the effect on the polypeptide of deleting base 7 on the wt DNA? Write the codon mutation changes for the mRNA and all changes in the polypeptide. Mutated DNA = 3' GTTACTTGCGGAAATTGACT 5' mRNA = 5' CAAUGAACGCCUUAACUGA 3' Polypeptide = Gln-Stop-Thr-Pro-Leu-Thr 5. What are the names of these types of base substitutions or addition/deletion mutations? Mutation in A Mutation in B Mutation in C
Madhur L.
Consider the following segment of mRNA produced by the nomal order of DNA nucleotides: CUU AAA CGA CAU a. What is the amino acid order produced from this mRNA? b. What is the amino acid order if a point mutation changes CUU to CCU? c. What is the amino acid order if a point mutation changes CGA to AGA? d. What happens to protein synthesis if a point mutation changes AAA to UAA? e. What is the amino acid order if an insertion mutation adds a G to the beginning of the mRNA segment? f. What is the amino acid order if a deletion mutation removes the $\mathrm {C}$ at the beginning of the mRNA segment?
Nucleic Acids and Protein Synthesis
Genetic Mutations
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD