Home
Ask directory
Biology
October 2025
20
Biology
Q&A Archive of
October 20, 2025
Select Question
October 20 of 2025
2. The females of two species of fruit fly, Drosophila melanogaster and Drosophila simulans release slightly different mating hormones called pheromones, which are used to attract male mates. a. geographic isolation b. behavioral isolation c. temporal isolation 3. A type of isolation in which…
CHAPTER 1 LEARNING EXERCISES WHICH IS THE CORRECT MEDICAL TERM? ect the correct answer, and write it on the line provided. 1. The term ________________________________ describes the surgical repair of a nerve. neuralgia neurorrhaphy neurology neuroplasty 2. The term…
Why do you think the reaction times to individual colors were longer when presented with a mixed stimulus (Part 2E) vs a single color stimulus (Parts 2C and 2D)? Explain physiologically. Paragraph Lato (Recomm... B I U A 19px Average Reaction Time: 308.75 msec The average reaction time for…
Which option best defines a paraphyletic group? a. a group that does not include the common ancestor of all its members and does not contain every species that descended from that ancestor b. a group that includes the common ancestor of all its members and does not contain every species that…
Question 7 of 10 © Macmillan Learning Under appropriate conditions, hemoglobin dissociates into its four subunits. The isolated $\alpha$ subunit binds oxygen, but the $O_2$-saturation curve is hyperbolic rather than sigmoid. In addition, the binding of oxygen to the isolated $\alpha$ subunit is…
UNIT 6 REVI Name Section Date Check Your Understanding Critical Thinking and Application Questions 1 Explain how the structure of each of the following relates to its function. a Compact bone: b Spongy bone: c Long bone: 2 A bone tumor disrupts the normal structure of osteons, replacing the…
Metta always goes to her town's New Year's Day parade. While the weather is always cold, this year temperatures are lower than normal, and the windchill is -2°F. Metta bundles up because she doesn't want to miss the parade and ends up being outside for almost two hours. What impact does cold…
Adult Drosophila lays 50-100 eggs per day, and each contains a shell made of so-called chorion proteins. These specialized proteins need to be produced at a very high level, at a precisely specific stage of oogenesis. The genes encoding chorion genes are clustered together. As a way to increase…
Q4.28. African elephants are iteroparous species, reproducing repeatedly through their lifetimes. Females begin reproducing around age 10, and have a calf every 4 years or so. The natural mortality of adult elephants is very low (when poaching and human-mediated stressors are excluded), so…
Stereochemistry (6 Marks - 1 Mark per response) Ivermectin is an antibacterial and antiparasitic natural product that is produced by fermentation cultures of the bacteria Streptomyces avermectilis. It is an inexpensive and well-tolerated treatment for river blindness in humans caused by the…
A 22 year old woman complains of weakness and fatigue that is worse in the afternoon and during prolonged activity, but improved by rest. On physical exam, DTRs and sensation are normal. Which of the following is the likely pathogenesis of the disease? O prevention of the release of…
Albert's squirrel and the Kaibab squirrel are distinct subspecies that live on opposite sides of the Grand Canyon. They were once one species, but now differ significantly, including fur coloring. a. geographic isolation b. behavioral isolation c. temporal isolation Of the seven species of…
Which of the following sentences is true? Select one: a. If a bacterium's cell volume decreases after being placed in solution A, then solution A is thermotonic relative to the bacterium. b. If a bacterium's cell volume decreases after being placed in solution A, then solution A is hypertonic…
Question 3 of 14 Place the steps of eukaryotic DNA replication in order, from when a germ cell enters gap 1 ($G_1$) phase to the cell cycle termination. Attempt 2 Cell enters gap 1 The initiation complex creates an active replication fork as helicase unwinds DNA. Each genomic origin of…
23. Using the individual processes listed in the box to the right, determine which of the following re the proper order of events involved in a skeletal muscle contraction? You might want to write these out on a separate piece of paper. A. Binding sites on Actin are exposed B. Actin and Myosin…
In Drosophila, the genes for body color and wing length are found on the X chromosome. Gray bodies ($$y^+$$) are dominant to yellow bodies ($$y$$) and long wings ($$m^+$$) are dominant to miniature wings ($$m$$). A male fly with a gray body and miniature wings is crossed to a female with…
1. Cardiac pacemaker cells are extremely important for normal regulation of heart rhythm. These autorhythmic cells undergo spontaneous action potentials caused by pacemaker potentials. How do these cells spontaneously depolarize (i.e., what happens?). How do they generate an action potential?…
1 mitochondrion 2 nucleus 3 sarcoplasmic reticulum 4 muscle fiber 5 myofibril Match each of the options above to the items below. A ______ is an intracellular structure that contains enzymes used to convert the energy in food into fuel muscles can use. A ______ is an elongated cell that runs…
Sep 30 eclass.yorku.ca Quiz 4 - Opens... Pre-class prep... Home Dashboard My courses Time left 2:59:37 1 out of Some Aleutian Islands are surrounded by urchin barrens while others are surrounded by kelp forests. Which statement gives the primary explanation for these differences? Select one: a.…
10:17 Back Pharmacokinetics tut.docx Tutorial: pharmacokinetics Consider the following scenario: a drug has a first order elimination rate constant of $0.5hr^{-1}$ and an apparent distribution volume of 3 litres. You wish to maintain a patient's serum levels of this drug above a level of…
+95 possible +100 +100 +85 Which statements about myosin are true? During muscle contraction, thick and thin filaments slide past each other causing an overall lengthening of the muscle. The tail of the myosin molecule acts as a molecular lever and binds ATP. In a muscle cell, myosin tails…
Part A When discussing photosynthesis, some people mistakenly talk about the light reactions and the dark reactions. Why is "dark reactions" an inaccurate name for the Calvin cycle? View Available Hint(s) Both the light reactions and the Calvin cycle are dependent on light. This implies that…
Yvonne has one copy of a gene for an X-linked dominant disease. She is fortunate to have a very mild form of the disease, which suggests that in the relevant organs, the X chromosome containing the dominant disease allele is silenced by X inactivation. If she has children with a man who does…
© Macmillan Learning The dominance pattern of a gene can be determined from the phenotypes of the parents and offspring. In the examples below, assume that each parent is homozygous for the specific allele and that the progeny are heterozygous. Classify each example as either complete…
8-11e0-9572-0800200c9a66/33c331a2-0bb1-448f-9ec9-70b15c3dc190/... Resources Al Tuto Side-by-Side Fe-S Learning d You decided to investigate the oxidation state of Complex III in the presence of Dr. Hoo's inhibitor to distinguish between KCN and antimycin A. Knowing the oxidation state of…
Which option best defines a polyphyletic group? O a. a group that contains the common ancestor of its members and/or all descendants of that common ancestor O b. a group that does not contain the common ancestor of its members but does contain all descendants of that common ancestor O c. a…
/2100 Resources Hint Submit Answ Hide < Question 14 of 21 > Put the steps of GroEL-GroES chaperonin function in order, starting with an unfolded polypeptide and ending with a polypeptide in its native conformation. © Macmillan Learning Unfolded protein Folded protein Answer Bank ATP is…
As the percent lean of a meat product increases, so does the price. What can frugal consumers do to save money without compromising heart health? Multiple Choice Use regular ground beef when making tacos, but rinse the browned ground beef under warm water to remove the excess fat before…
My Course - Biochemistry-1 Protein stability interactions show the tertiary structure of hub/assessment/f188d950-dd73-11e0-9572-0800200c9a66/27fa2ad8-4363-4806-91f3-bd7921e35cbe/d262da07-afab-41 pts Question 4 of 10 A small generic section of the primary structure of an $\alpha$ helix is given…
You are investigating certain plant taxa in your neighborhood. You come across a plant that you are pretty sure is an angiosperm, but you are not certain without your handy field guide. Which of the following characters of the plant could you use to convince your neighbors that the plant is an…
Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus? a. A translation stop codon is added to the 3' end of the pre-mRNA. b. Sequences called introns are removed by spliceosomes. c. A polyA tail is added to the 3' end of the mRNA. d.…
Question 2 (Q002) Adaptations are permanent traits that may result from natural selection. temporary responses to physiological stress. the same as acclimatizations. reversible, short-term adjustments. Question 3 (Q003) What is the definition of hypoxia? condition in which the body is getting…
Question 7 2 pts Un suelo A-1 en la clasificación AASHTO es más adecuado para carreteras que un suelo A-7. True False Question 8 2 pts Los suelos con baja densidad relativa tienden a ser más estables en cimentaciones. True False Question 9 2 pts Las rocas sedimentarias se forman a partir de la…
5.00 Points Possible | Due Wednesday 10/01/25 at 9:00 AM Which of the following statements best describes the concept of epistasis? O The interaction between genes in which one gene masks or interferes with the expression of another. O Multiple genes working together to control a single…
If the statement is true, write True on the line. If the statement is false, write False on the line. 1.61. True An erythrocyte is commonly known as a red blood cell. 1.62. False Arteriomalacia is abnormal hardening of the walls of an artery or arteries. 1.63. A colostomy is the surgical…
2 Ch chegg - Search is part of the citric My Course - Introdu d950-dd73-11e0-9572-0800200c9a66/33c331a2-0bb1-448f-9ec9-70b15c3dc190/... Resources AI Tutor Side-by-Side ETC inhibitors rs you are looking ssium cyanide. ginning with er of electrons from quinone. Learning Considering the whole ETC…
Three-month-old Mary Jo can hold her head up when in the arms of an adult, but she doesn't yet have much control of what her legs do. Which one of the following best describes Mary Jo's progression in muscular control? A It shows a cephalocaudal trend, which is typical. B It shows a definite…
Q 3 - You are studying a gene that controls ossicone (horn) length in giraffes. The wild-type long- ossicone allele ($$L$$) is dominant to the mutant short-ossicone ($$l$$) allele. However, the $$L$$ allele is only 60% penetrant in both homozygotes and heterozygotes. In a population of giraffes…
Wrong answer Question 5 0 / 1 pts On the following diagram, assume two character states (- and +) for each character, and that + represents the derived state. Characters 1-5 change state in the positions indicated on the tree diagram. If you were to reconstruct the data matrix that yields the…
* Posterior root (what type of neuron is found there?) Sensor * Posterior root ganglion (what part of a neuron is clustered here?) * Anterior root (what type of neuron is found there?) motor, e * Posterior gray horn (what types of cell bodies are found there?) * Anterior gray horn (what types…
Several members of a family have polydactyly, and they differ in their numbers of extra fingers and toes. Yet, certain relatives who should have extra digits don't, such as Megan. Megan's father has an extra digit on each hand and foot, and she has two children, a son with two extra fingers and…
What are the four "PUBS" signs of possible alcohol overdose, as provided by the Gordie Center? Select one: Pulse is rapid; Unresponsive to pinch; Blurred vision; Skin is blue, cold or clammy. Puking while passed out; Unresponsive to pinch or shaking; Breathing is slow, shallow, or has…
Choose the correct statement about the difference in entry mechanisms between bacteriophages and animal viruses. Bacteriophages "push" their genomes inside the host cells leaving the capsid outside as a ghost. Only bacteriophages enter the host cells as an intact virion (genome+capsid). Animal…
TicToc Corp. is a manufacturer of smart watches that track the wearer's heart rate and sleep patterns. Which of the following is most likely an implication of new firms entering this industry? Multiple Choice The rivalry among existing competitors will reduce. The incumbent firms will spend…
Types of Strength Training (Keyboard Navigable Alternative Version) Match each type of training to its description. 1 Isometric (static) exercise 2 Dynamic exercise 3 Isokinetic exercise Match each of the options above to the items below. Exertion of muscle force through a joint's range of…
Which option best defines a monophyletic group? a. a group that consists of a common ancestor and all of its descendant species, but no other species b. a group that does not include the common ancestor and all of its descendant species c. a group that consists of a common ancestor and some of…
Part A Your teacher wants you to mix up the enzymes and substrates necessary to perform the Calvin cycle in a test tube. To control the reactions, you wish to do this in the absence of the light reactions, without whole chloroplasts, and with no cells present. What components do you need to put…
Mike is a 56 y/o male who lives in an abandoned building. With about 40 other street people. He comes to the clinic with a social worker who describes his symptoms as: a cough, dyspnea, pleuritic chest pain, fever and tachypnea. Your physical exam notes that he has some consolidation in the…
Part A Which of the following statements is true of the electron transport chain that follows photosystem I? View Available Hint(s) An electron that will be absorbed by a primary electron acceptor is energized. Water is split into oxygen and hydrogen ions. Hydrogen is pumped across its…
Which of the following statements best describes the location of the water molecules in the crystal structure of the DNA doubl helix? [Hint: make the water molecules visible and color the DNA atoms and bonds gray.] Water is equally distributed in the interior and exterior of the double…
In a hypotonic solution, an animal cell will neither gain nor lose water. shrivel. experience turgor. lyse. Question 7 (1 point) Listen Facilitated diffusion across a biological membrane requires _______ and moves a substance _______ its concentration gradient. energy and transport proteins;…
Types of Workouts (Keyboard Navigable Alternative Version) Match each type of workout to its description. 1 upper- and lower- body split workout 2 Total body workout 3 Muscle group split workout Match each of the options above to the items below. A general-fitness workout targeting multiple…
Some of the enzymes involved in DNA replication participate in DNA repair, which is not surprising given that both processes involve the same DNA molecule. In the spaces provide, compare and contrast the process of DNA replication with the process of DNA repair. DNA Replication DNA Repair…
A patient is admitted with flaccid weakness of the arms and lower legs. There is a one week history of burning sensation and weakness occurring in the lower limbs that later progressed to the arms. On examination, there is a loss of deep tendon reflexes bilaterally. The patient also states he…
Part A A coleus plant has variegated leaves showing a variety of pigments. If this plant has a high percentage of leaf coverage that appears yellow and orange mottled among the green portions of the leaf, what type of pigments would be associated with the yellow and orange sections of the…
6 Which of the following statements describes how thromboembolism affects stroke patients? A) Venous thromboembolism (VTE) is difficult to diagnose in older patients, in part due to reduced sensitivity in patients B) VTE is an uncommon problem in stroke patients whereas symptomatic…
The distinction between complex and polygenic traits is that Multiple Choice polygenic traits are caused by more than one gene, and complex traits are caused by only one gene polygenic traits are caused by more than one gene, and complex traits are caused by one or more genes as well as…
Chrome File Edit View History Bookmarks Profiles Tab Window Help myfsu Po Mail - Mi Sherpath Elsevier A eaqng.elsevier.com... Relaunch to update perdue owl apa cit... purpose game to h... Science - OpenStax All Bookmarks Quit Report content err Study mode ON Question 36 of 50 Which arterial…
Which option best defines bootstrap resampling? a. a statistical technique for quantifying how strongly a data set supports a given phylogenetic relationship b. a statistical technique for quantifying how strongly a phylogenetic tree matches the true evolutionary relationships c. a statistical…
What 3 things should a salesperson confirm when selling an appointment? O location of office, reason for appointment, time needed for call O specific reason for appointment, amount of time needed, and specific time to meet O location of office, amount of time needed and specific time to meet O…
5.00 Points Possible | Due Wednesday 10/01/25 at 9:00 AM Which of the following statements about the rabbit coat color alleles is true? O The Himalayan allele is recessive to all other alleles. O The albino allele is dominant over all other alleles. O The wild-type allele is dominant over…
6 Multiple Choice 2 points Which of the following is NOT true about the lagging strand? Utilizes Okazaki fragments that are later linked with enzyme New DNA on this strand is being synthesized in a 3' to 5' dire Synthesis is in short segments as DNA unwinds Replication is discontinuous on this…
Categorize each rate based on whether it would increase or decrease in the presence of a membrane uncoupling agent. Note: Please read through the entire solution for the conclusion of this case. Increase Decrease Answer Bank rate of glycolysis rate of pyruvate utilization by the PDH…
The difference in mode of inheritance between Huntington disease and cystic fibrosis is that Multiple Choice A person with Huntington disease can have unaffected parents, but a person with cystic fibrosis must have an affected parent Huntington disease does not skip generations, but cystic…
Which rationale is correct regarding administration of Rho(D) immune globulin to the mother immediately after delivery after review of the blood test results of a postpartum patient and the neonate? O The neonate and the mother are Rh positive. O The neonate and the mother are Rh negative. O…
2. The per capita growth rate of country Y in the year 2024 was 5%. If the population size of country Y was 10 million at the beginning of 2024, what was the final population size at the end of 2024? Note: Per Capita Population Growth Rate = (Final Pop. Size - Initial Pop. Size) divided by…
A recent GWAS study looked for SNPs associated with bipolar disorder. There were two groups of study participants, those who had bipolar disorder, and those who did not. Aside from this difference, the people in the groups were chosen to be as similar as possible with regards to things like…
Question 27 A 9-year-old boy receives the chickenpox (varicella) vaccine. Two years later, he is exposed to a classmate with chickenpox but does not get sick. Which adaptive immune process best explains his protection? O Memory B and T cells responded quickly to the virus O Innate immunity…
Part A Which event in the sequence of photosynthesis occurs before all the others in the list? View Available Hint(s) Carbon dioxide is converted into sugar. Oxygen is produced. Photons of light stimulate pigments within the thylakoid membrane inside of a chloroplast. Energy carrier molecules…
Which of the following is not involved in establishing lysogeny for phage lambda? O Rolling-circle replication generates multiple genomes in tandem, which are eventually cleaved by the enzyme terminase. O Lambda phage DNA integrates as a prophage in the host genome. O Once integrated in the…
Part C (3 of 5) - Follicular phase and the surge of estrogens 3 tries left Secretion of large amounts of estrogens by the dominant follicle directly and indirectly leads to which of the following? Select all that apply. A surge in LH release Increased release of GnRH Initiates a positive…
You have made nutrient-rich (aka rich) Saccharomyces media. Which of the following statements is true about this media? No strains will ever grow on this media. All strains can grow on this media. Only strains that are auxotrophs for all nutrients can grow on this media. Only strains that are…
Part A In the autumn, plants break down their chlorophyll, and leaves reveal some of their accessory pigments. Oaks, for instance, may reveal yellow to orange pigments that have always been there but are only revealed when chlorophylls are not prominent. Which wavelengths of light in the…
When $$Ca^{2+}$$ binds to calmodulin, a large conformational change in calmodulin's EF hands occurs. This conformational change exposes hydrophobic residues on the protein's surface. How might this structural change help to propagate the calcium signal? by allowing calmodulin to bind to other…
Question 7 of 21 Consider that electrons will back up in the chain and accumulate at all steps before the blocked step. Remember that there are two pathways for electrons to enter the ETC, and these pathways converge with the transfer of electrons from ubiquinone to Complex III. Besides…
Out in the open ocean (pelagic zone), the regions are described by the amount of light they receive. Match the zone with its description. aphotic zone euphotic zone disphotic zone [ Choose ] dark - light cannot penetrate to this zone this zone has light, and photosynthesis occurs here also…
- Academy - FIN 350 - Phase 1.xlsx - iso-20241231 - Sign in - Ctrl K - Catalog - What would you like to learn? - Question 8 of 60 - Time remaining: 02:56:40 - True or false: If neither variation in an A/B is statistically better, you pick the variation you like best and proceed to make the…
Glucose polymerizes to form cellulose, starch, and glycogen. Which of the following is true? O Cellulose is the most stable of the three. O In cellulose and starch, glucoses are connected with beta-1,4 linkages, while glycogen uses alpha-1,4 linkages. O Digestion of starch requires the…
Claude Bernard's use of curare and John Langley's use of nicotine: damaged the fibers of skeletal muscle, so that it could not contract. indicated that a chemical transmitter released from nerve cells had an effect on skeletal muscle cells. proved that an electrical impulse passed from nerve to…
Question 38 A 6-year-old girl develops hives, swelling around her lips, and difficulty breathing within minutes of eating a peanut butter cookie. Which alteration in immunity is most likely responsible for her reaction? O Type I hypersensitivity involving IgE and mast cell degranulation O Type…
Question 3 Complete the sequences below describing the movement of H+ and electrons during oxidative phosphorylation. Path of H+ flow. 1. Removed from NADH or FADH₂ 2. Through Complex 3. Through ubiquinone 4. Through Complex 5. Through cytochrome c 6. Through Complex IV 7. Bonds from O2 to form…
In the third quadrant of your streak for isolation, you see two different colony morphologies: one is yellow, round, convex, with entire margins, and the other is white, umbonate, with lobate margins. Which of the following is the best explanation. a) You forgot to flame your loop between…
NAME 1. A heptapeptide when treated with trypsin produced two peptides with the following composition: (Separation by commas indicates an unknown sequence) 1. Asp, Gly, Tyr 2. Lys, Phe, Val, Ala When the heptapeptide was treated with chymotrypsin, three peptides were produced: 3. Lys, Tyr,…
4. A 29 year old male falls 17 feet (5 m) to the ground from a tree. He complains of pain with movement and pain on the right side of his chest when he breathes. You note accessory muscle use, focal tenderness, bony crepitus, and absent breath sounds on his right side. What should you…
AMD is an age-related disease, as are several other common eye diseases. Which dietary food categories exacerbate (increase or promote) the risk and severity of AMD? A) Fried foods B) Processed foods C) High-sugar foods (added processed sugars such as sucrose, glucose, fructose) D) Meats with…
Karen and Anika are owners of a new personal assistant service called Assist You 2. They live in an area populated by single professionals, small local business owners, retired senior citizens, and families with little kids. For Karen and Anika, each of these groups, or segments, is a…
Question 17 1 pts Which weight categories are associated with a higher risk of early deaths? Underweight and obese Overweight and obese Underweight Underweight, overweight, and obese Question 18 1 pts Jahzara is studying for a nutrition quiz on energy expenditure and is reviewing factors that…
G1/S checkpoint G2/M checkpoint Spindle-assembly checkpoint maintains cell until necessary enzymes for replication are synthesized detection of DNA damage after replication ensures that each chromosome is attached to spindle fibers from opposite poles Answer Bank What are…
The lambda genome is replicated by a rolling-circle mechanism. What is the result after a round of replication? O a concatemer (i.e., multiple genomes joined end to tail, which are cleaved by a terminase), producing linear double-stranded DNA prior to packaging O several circular molecules…
QUESTION 1 OF 10 Why do groups haze? CHOOSE AN OPTION BELOW It's tradition. Some may view hazing behavior necessary to bond. The idea of going through an initiation fulfills a basic need, and individuals seeking to be part of a group are sometimes willing to haze, regardless of the…
2025 Fall Term A Home Announcements Assignments Grades Modules CU Book Access People Syllabus Zoom Lecture Recordings Lecture Recordings Question 2 1 pts +1 START A: 5'-GGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGTATGCAAGGGGCGAGGA B: 3'-CCAAATCACTTGGCAGTCTAGGCGATCGCGATGGCCAGCGGTGG…
Question 33 A 72-year-old patient is recovering from hip surgery and develops pneumonia after 5 days in the hospital. The nurse explains that this type of infection is especially concerning because: O Iatrogenic infections are often caused by antibiotic-resistant organisms O It is considered a…
Answer By discussing chromosomal mutations, I mentioned that it appears that the human Chromosome 2 is the result of two separate chromosomes present in an ancestral species. Chimpanzees and bonobos, our closing living relatives, have the ancestral condition of having 24 (not 23) pairs of…
Some combinations of recessive alleles cause problems so severe that a fetus may cease to develop. Such lethal allele combinations appear to alter Mendelian ratios because Multiple Choice homozygotes for the lethal allele pass it on to half their offspring. homozygotes for the lethal allele do…
Increased cardiac output and myocyte loss. Question 2 (2.5 points) Which of the following best explains the pathophysiological mechanism responsible for the patient's pulmonary crackles and shortness of breath? Increased right ventricular preload causing pulmonary artery hypertension Left…
Hershey's sustainability strategy is focused on protecting the company's investment in its product for many years to come by all of the following except Multiple Choice maximizing quarterly profits. having a long term view cocoa farming is seen as a great livelihood ensuring that the…
What is not a principle of cancer chemotherapy? Drug kills a constant proportion of tumor cells rather than a constant number Adverse effects are decreased by giving combinations of drugs with different side-effects Combining drugs with different mechanisms is more effective Cure does not…
5 Multiple Choice 2 points Social determinants of health (SDOH) contribute to a wide variety of health disparities amongst different population groups. SDOH could be best described as: Someone's personal desire to improve their own health. How someone's family convinces them to take action…
Part A Where is the most energy used in the Calvin cycle? View Available Hint(s) in the fixation of $$CO_2$$ to RuBP in the linkage of two G3P molecules together to form glucose in the regeneration of RuBP in the conversion of PGA to G3P in the rearrangement of the six-carbon molecule made from…
Sam is a 19 y/o male who comes to the clinic with a chief complaint of several weeks of fatigue and non-productive paroxysmal coughing. He initially had a sore throat, some rhiniti and low-grade fever Potential organisms that might have caused Sam's condition include which of the following: O…
Regina's pregnant sister is interested in boosting her intake of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), two omega-3 fatty acids that can be made from alpha-linolenic acid. She has heard that EPA and DHA are important for cancer prevention, brain health, cardiovascular…
The idea that femaleness is simply what happens when an embryo does not develop as a male is no longer supported by evidence because of the discovery of Multiple Choice the SRY gene in females gene that suppress all of the genes on a female's Y chromosome hormones that suppress expression of…
Q 4. Which of the following is the best definition of cellular respiration? the complete oxidation of glucose to CO2 and H2O a sequence of redox reactions with O2 as the final electron acceptor a sequence of redox reactions with the final electron acceptor from the environment a method of…
to Psychology / Benchmark 5: Checkpoint 12-14 page Time left 0:54:47 During the stage of resistance, what happens to the body when faced with a persistent stressor? Select one: O a. The body experiences chronic fatigue. O b. The body enters a state of relaxation. O c. The body adapts by…
Multiple Choice Some human disorders are caused by the presence of an entire extra chromosome. In these cases, instead of having 2 of a certain chromosome in each cell, the individual may have 3 of that chromosome in each cell. What genetic test would be most useful in determining if an…
a complex carbohydrate like cellulose Question 2 (1 point) Saved Listen Why does ADP have less potential energy than ATP? because ADP has only one phosphate group because ADP has only two phosphate groups because ATP has ribose as a sugar because ATP has adenine in it Question 3 (1…
Question 5 Which statement made by a patient attending an educational session indicates understanding regarding the structure and function of the male reproductive system? "The prepuce is the smooth end of the penis." "Surgical removal of the foreskin is called circumcision." "The proximal end…
According to the concept of endpoint control, voluntary reaching movements to a location in space A are planned based on the desired distance from its starting point. B are planned based on its desired final location. C require sensory feedback that arrives after an effector has been moved to…
Which of the following best exemplifies the term gender? Select the best answer. 1) Shakayla loves hanging out with her lady friends and talking about fashion. 2) Terrance was born with genitalia that are not clearly male or female. 3) Eric has the typical hormone levels of a male and the…
6. The barred pattern of chicken feathers is inherited by an X-linked gene. The dominant allele, $$X^B$$, causes barring and the recessive allele, $$X^b$$, causes no bars. In poultry, females are XY and males are XX. a) A non-barred rooster is crossed with a barred hen. What are the genotypes…
Select the true statements about denaturation. A zymogen is a denatured form of a proteolytic enzyme. Denaturation and digestion refer to the same process. Egg white meringue contains denatured egg white proteins. Protein denaturation involves cleavage of its peptide bonds. Denaturation of an…
Dichlore Logout Nearpod Fraction Untitled preferen ware.visiblebody.com/courses/136879/assignments/13222525/launch?activity_index=0&a=13222525&j=%0E%08%03%07 Canvas Nearpod VB Visible Body Webassign Instructor: Jacob Maxson Email: jamaxson@gmail.com Previous Activity 16 of 16 ice ed 7. What is…
Question 5 7 pts Which one of the following statements is false? Conductors have low resistivity and insulators have high resistivity. Resistivity does not depend on temperature of the material. Resistivity is a function of temperature. The resistance R of a wire with length L, cross-sectional…
1 Point Building off of work in animals on central pattern generators, epidural stimulation in humans can improve locomotion in paralysis patients by A stimulating the muscles impacted by spinal cord damage. B stimulating the muscles at a frequency related to the locomotion cycle. C providing…
Which of the following describes the cervical enlargement? A large area of spinal cord gray matter needed to innervate the upper extremities A large area of spinal cord white matter needed to innervate the lower extremities A large area of spinal cord gray matter that houses autonomic motor…
Which of the following is a correct ordering of the listed compounds from highest phosphoryl-transfer potential (most favorable delta G of hydrolysis) to lowest phosphoryl-transfer potential (least favorable delta G of hydrolysis)? O ATP, 1,3-Bisphosphoglycerate, phosphoenolpyruvate, glycerol…
Choose the sentence that uses verb forms correctly. Choose one answer. If I had a disease with the symptoms of streptococcus A, I would visit a doctor immediately. If I had a disease with the symptoms of streptococcus A, I will visit a doctor immediately. If I have a disease with the symptoms…
Question 3 0.5 pts It is important to add the activated charcoal to the cool solution before heating. It should not be added to a boiling solution because... It can cause the solution to foam up and boil over. It can spit and result in burn hazards. It can result in low sample recovery. All of…
Part D (4 of 6) A patient is admitted to the hospital with the following plasma values: pH = 7.2, Pco2 = 25 mmHg, and HCO3 = 18 mEq/L. What is the acid base imbalance? O metabolic acidosis with no compensation O metabolic acidosis with respiratory compensation O metabolic alkalosis with…
234/300 Eukaryotic DNA replication is different from prokaryotic DNA replication in all of these ways EXCEPT unlike prokaryotes, eukaryotes typically have multiple origins of replication. nucleosome assembly must immediately follow DNA replication in eukaryotes whereas this is unnecessary in…
Inside eukaryotic cells, misfolded proteins within the secretory pathway can be recycled by a quality-assurance mechanism. Arrange the steps in this process in their correct chronological order with the earliest step at the top. Instructions Ubiquitin is attached to defective protein. The…
Academy FIN 350 - Phase 1.xlsx fin-20341231 Sign in MKT Catalog What would you like to learn? Question 36 of 60 Time remaining: 02:37:16 Checking for statistical significance when testing a new marketing channel ensures: You developed a strong hypothesis. You've chosen the correct KPIs. You…
Paragraph Q4.3- Explain in molecular terms how binding of $$O_2$$ to $$Fe^{2+}$$ in hemoglobin causes a protein conformational change resulting in a 1 Å tilt in the F helix. Be specific. Describe three conditions that explain why hemoglobin is fully saturated with $$O_2$$ in the lungs and how…
Part A What is the role of $$O_2$$ in photosynthesis? View Available Hint(s) $$O_2$$ is a product of the light reactions. $$O_2$$ is a reactant in the light reactions. $$O_2$$ is a reactant in the Calvin cycle. $$O_2$$ is a product in the Calvin cycle. $$O_2$$ is a both a reactant and a product…
Write the correct answer in the middle column. Definition Correct Answer Possible Answers 1.26. white blood cell acute 1.27. prediction of the probable course and outcome of a disorder edema 1.28. swelling caused by an abnormal accumulation of fluid in cells, tissues, or cavities of the…
9 How do researchers in the metagenomics sector operate? 01:02:32 Multiple Choice They collect and sequence DNA, then consult databases of known genomes to imagine what the organisms to which the DNA belongs might be like. They study Mendelian traits in children. They link diseases by shared…
Carrie, 18, tries to get 7 - 8 hours of sleep per night, but she still has trouble waking up in the morning, and she feels drowsy during her afternoon classes. What might be the problem? Carrie is not getting enough sleep Carrie needs to take melatonin supplements Carrie needs to wake up…
19 of 33 Concepts completed Multiple Select Question Select all that apply Which of the following statements are true of cumulative preferred dividends? (Select all that apply) Preferred shareholders receive no interest on the cumulated dividends. Directors elected by common shareholders cannot…
Clear my selection 7 Multiple Choice 2 points Which statement about primase is true? It adds a ribonucleotide to the 3' end of a growing RNA molecule It reads template DNA 5' to 3' It separates bonds between nucleotides during DNA replication It adds RNA bases that provide a free 3'-OH group…
Extension Questions Question 1 Many microbe species, including the yeast from this experiment, are facultative anaerobes that can metabolize sugars by both aerobic respiration and by fermentation. Apply your knowledge of these processes and yeast metabolism to suggest the optimal growing…
Multiple Choice 2 points Which of the following is NOT an important feature of DNA replication? It proceeds in a 5' to 3' direction DNA replication is semiconservative All of the above are important features of DNA replication There are multiple origins of replication along a linear…
A 60-year-old male with a history of moderately chronic severe COPD has recently weaned off a long course of corticosteroids. He presents now with headaches that are worse with straining. He also complains of double vision and blurriness. What is most likely to be found on physical exam? O…
Question 3 Which of the following statements is incorrect? O DNA methylation would lead to open chromatin and gene activation. O Histone acetylation would lead to open chromatin and gene activation. O DNA methylation occurs on the cytosine nucleotide. O Histone methylation occurs on the Lysine…
Psychology / Benchmark 4: Checkpoints 9-11 / Benchmark 4: Checkpoints 9-11 What is the primary function of the trillions of synapses that form in a baby's brain during infancy? O a. To control muscle movement O b. To create a complex neural network for future learning O c. To store memories O…
What was the most common pattern for an adult to come to stand? Upper extremity reach, symmetrical push, forward head neck, and trunk flexion, and a symmetrical squat Symmetrical push and reach followed by half kneel Upper extremity reach, asymmetrical push, forward head neck and trunk flexion…
If plants were no longer able to perform the light reactions and they could only utilize the Calvin cycle, which of the following wo be true? Check All That Apply Plants would not produce oxygen. G3P would be produced in much smaller quantities. NADPH production would decrease while ATP…
Chrome File Edit View History Bookmarks Profiles Tab Window Help myfsu Por Mail - Mi Sherpath Elsevier A eaqng.elsevier.com... Relaunch to updat perdue owl apa cit... purpose game to h... Science - OpenStax All Bookm X Report content error Study mode Quit Question 29 of 50 Which percentage of…
1. Peptone A. refers to a hydrolysis of carbohydrates used in growth media. B. refers to a hydrolysis of proteins used in growth media. C. consists of a water extract of beef. D. consists of a mix of monosaccharides and oligosaccharides. E. refers to a hydrolysis of proteins used in growth…
Estes and his colleagues speculate that the decline in otters during the 1990s was due to a(n) _____. Select one: O a. infection by hantavirus. O b. sudden increase in the numbers of urchins. O c. switch in the predation patterns of killer whales (orcas) to include more otters. O d. decrease in…
BACTERIAL GENETICS • BACTERIAL TRANSFORMATION INTRODUCTION LABORATORY SIMULATION Match the inoculated agar plates with their expected growth after incubation. -pGLO on LB/amp Choose match +pGLO on LB/amp/ara Choose match +pGLO on LB/amp Choose match -pGLO on LB Choose match What steps were…
Which statement about the actions of aldosterone in regulating water and electrolyte balance is correct? Select all that apply. One, some, or all responses may be correct. Secreted when blood pressure is low Decreases renal reabsorption of sodium Increases renal reabsorption of…
Question 17 (1 point) What is the concept of "body doubling" in the context of work? A strategy for increasing physical exercise during work hours A way to conduct multiple tasks simultaneously for better efficiency A method of working in complete isolation to maximize focus A technique that…
Question 22 Leilani's RDA for mineral 'Y' is 50 micrograms/day. Would mineral 'Y' be considered a minor/trace mineral? O No, because the RDA is less than 100 milligrams/day. O No, because the RDA is less than 100 micrograms/day. O Yes, because the RDA is less than 100 micrograms/day. O Yes,…
Which ventilation-perfusion information is relevant for understanding atelectasis and pulmonary edema? Select all that apply. One, some, or all responses may be correct. The ventilation-perfusion ratio will be low. Shunting will occur. Alveolar dead space will be increased. The pulmonary…
Please match the following structure and function. brain stem Gateway to the cerebral cort Cerebellum Control movement; found de Thalamus Attention, perception,proces Cerebral cortex Control movement; found de Corpus callosum Connecting the two hemisphs Hippocampus Learning and…
dysfunction Question 3 (2.5 points) What is the most likely pathophysiological cause of the patient's jugular venous distension and bilateral pitting edema? Left ventricular failure causing increased systemic venous return Severe mitral regurgitation causing left atrial volume overload Right…
According to the Spencer-Bain principle, __________. intelligence comes from sensory acuity smaller populations are more exposed to evolutionary pressures the probability of a behavior is increased if it is followed with a pleasurable outcome and decreased if it is followed by painful…
A mutation in RNA polymerase III would likely result in which of these consequences? There would remain an abundance of RNA components in the nucleus. Amino acids will fail to attach during the elongation phase of transcription. The cell would no longer be regulated in its gene expression. The…
Canvas Question 48 In a type IV delayed hypersensitivity reaction how will you know you have been exposed to an antigen? O Your body undergoes a normal immune response O You will cough and have a fever O You will see a skin reaction with the second exposure O You will not know you have been…
16. The transcriptionist recognized the name of a patient as that of the son of a friend of hers. The report indicated a good prognosis for the child. Because the mother had been depressed and uneasy for her child, the transcriptionist felt it was all right to telephone her and reassure…
What is the link between aspartame and cancer? Aspartame has not been approved by the FDA, so there is no way to assess cancer risk. A study showed that aspartame causes bladder cancer in rats. Aspartame has been linked to multiple kinds of cancer. There is no known, consistent association…
Question 2 2 pts You would like to offer a service to the researchers in your institution for identification and quantitative analysis of proteins produced by microorganisms in liquid media using your HPLC-mass spectrometer system. Which one of the ionization techniques is best suited for this…
Question 10 Which statement by a participant in an educational session indicates understanding about expected findings in the reproductive system? "Vaginal pH is normally alkaline." "The wall of the vagina becomes rougher during menopause." "Ovarian hormones control the amount of fluid in the…
Which pathophysiology statement reflects understanding of a client's diagnosis of Goodpasture syndrome? Antigen-specific immunoglobulin E (IgE) binds to the surface of basophils and mast cells. Autoantibodies attack the glomerular basement membrane of the kidney. Rapid and systemic reactions of…
When excess nutrients such as nitrogen and phosphorus, from fertilized fields runs into a stream, the stream becomes eutrophic, or overly nutrient rich. Such eutrophication may lead to: Select one: a. Decreased levels of phosphate b. Decreased levels of nitrogen c. Decreased microbial diversity…
1 Multiple Answer 10 points Select all of the following that would be an example of movement in the human body. formation of a new organism from a parent organism an increase in body size air coming into and out of the lungs red blood cells going from the heart to the capillary in your typing…
SIRS (systemic inflammatory response syndrome) is defined as: A. The body's response to low fluid volume manifested by altered perfusion and shock B. The body's response to a variety of nonspecific insults manifested by altered mental status, elevated heart rate (tachycardia) C. The body's…
Polling How can ecological disturbance, such as habitat loss, contribute to the outbreak of a new viral disease in humans? A. Disturbances bring humans and reservoir hosts together in new ways. B. Ecological disturbances increase the rate of mutations. C. Viruses would respond by mutating to…
Question 37 of 42 Which statement accurately describes the relationship between cor pulmonale and heart disease? Left-ventricular failure causes pulmonary venous congestion and pulmonary edema. Impaired ventilation causes decreased oxygenation, which precipitates cardiac…
Match the following terms to their definitions hyphae that have hundreds or thousands of nuclei in a continuous mass specialized hyphae found on mycorrhizae reproductive elements in fungi that are spread by wind or water network of hyphae that infiltrate a food source reproductive…
Which of the following statements is true about the promoter of a protein-coding gene? a. The promoter is a non-transcribed region of a gene. b. The promoter is part of the RNA molecule. c. The promoter is a site at which only RNA polymerase can bind. d. The promoter is a site found on RNA…
Part A The mass extinction of dinosaurs after a giant asteroid collided with the earth 66 million years ago was linked to a massive decline in plant life. What critical input for photosynthesis was dramatically reduced after the asteroid impact and resulting fires? View Available…
© Macmillan Learning Match each description to the term it defines. Gene Allele Chromosome Answer Bank an alternative forms of a particular gene a chromosomal region that codes for a functional transcript a functional unit of heredity threadlike DNA molecules that are visible during…
Elsevier Adaptive Quizzing Elsevier Adaptive Quizzing Elsevier Adaptive Quizzing Report con Question 27 Which underlying premise is part of the stepwise approach for asthma control? Daily exercise improves oxygenation. Balance diet, exercise, and drugs. Increase or decrease drugs until a…
Which of the following statements is incorrect? Folic acid in food can serve as methyl-group donor for both histone and DNA methylation. Epigenome is dynamic and responds to environmental changes. Enzymes that catalyze DNA methylation can also catalyze histone methylation. For genes that are…
0 of 50 Concepts completed Multiple Choice Question The tube that receives sperm from the epididymis is called the _blank_. perineum gonad ductus deferens seminal vesicle Need help? Review these concept resources. Rate your confidence to submit your answer. High Medium Low © 2025 McGraw Hill.…
Select the correct answer, and write it on the line provided. 1.21. The term _________________________ describes any pathologic change or disease in the spinal cord. myelopathy myopathy pyelitis pyrosis 1.22. The medical term for higher-than-normal blood pressure is…
Question 3 1 pts From the reading: The endocrine function of adipose tissues in health and cardiometabolic disease During periods of calorie surplus, how does white adipose tissue expand? Increasing number of adipocytes (hyperplasia) Increasing size of adipocytes (hypertrophy) Transforming into…
(Select all that apply) Which of the following is/are true about active transport? It uses energy obtained from the breakdown of ATP. It uses transmembrane proteins that are capable of changing shape. The transport can happen against concentration gradient. It transports large, polar…
What molecule has Emily's Planner Mail - Emily Rezen Identify practical s 60637 New Chrome availa 12:35 Time Remaining Return Next 22/25 22 Multiple Answer 1 point Select the stages of the cell cycle during which each chromosome consists of two chromatids joined at the…
Aerobes may tolerate the presence of oxygen because they have one of several enzymes that can detoxify toxic oxygen by-products such as hydrogen peroxide or superoxide. One such enzyme is superoxide dismutase. Another one that we learned about in lab is: Select one: a. DNA gyrase b. RNA…
A 22-year-old female presents to the ED with complaints of severe muscle weakness after any exercise. She also complains of drooping eyelids and diplopia that worsens throughout the day. Sensation and deep tendon reflexes are normal. Which of the following diagnosis is most appropriate? O…
Question 45 1 P Four patients in labour all request epidural analgesia to manage their pain at the same time. Which ethical principle is compromised when only one anesthetist is on call? A Beneficence B Nonmaleficence C Justice D Autonomy Last saved 12:12:55 PM Questions Filter (50) K First <…
Question 15 A nurse knows that the key characteristic of an opportunistic infection is: O It only occurs in individuals with weakened immune systems. O It can be treated with any available antimicrobial agent. O It is transmitted through direct contact with an infected individual. O It is…
Nearpod VB Visible Body Webassign Instructor: Jacob Maxson Email: jamaxson@gmail.com < Previous Activity 16 of 16 5. In a long bone, yellow bone marrow is found in the and red bone marrow is found in the a. Compact bone, trabeculae b. Medullary cavity, spongy bone c. Central canal, medullary…
Question 2 4 Points Some endurance athletes use wearable sensors while training to monitor muscle oxygen saturation ($$SMO_2$$). Suppose an athlete's wearable sensor gives $$SMO_2$$ readings that are always 10% lower than the athlete's actual muscle oxygen saturation. Measurements taken with…
Which of the following are true regarding upper motor neurons? The neurons in primary motor cortex are upper motor neurons Damage to upper motor neurons may result in dysarthria Upper motor neurons are the motor neurons that are connected to the facial muscles that move during speech. a &…
rep Part A What is the purpose of a cuticle on a leaf? View Available Hint(s) to bring in more light to carry sugar down to the roots to prevent water loss to perform photosynthesis to allow CO2 to enter the cell to carry water to the rest of the leaf Submit Provide Feedback
Question 20 of 20 00:06 HR MIN SEC Submit All © Macmillan Learning An organism's inherited traits that increase its likelihood to reproduce and survive are the traits it will most likely pass on to the generations that follow. This pattern can be explained by the principle of: O…
Select all of the following that describe logistic population growth. Check All That Apply Population growth slows as resources become limited. The larger the population size, the faster it grows. Population size stabilizes at the carrying capacity. An explosive growth period continues because…
10 of 33 Concepts completed Multiple Select Question Select all that apply Which of the following ratios might be used to estimate the value of a stock? (More than one answer may be correct) the price-earnings ratio the book-to-value ratio the price-sales ratio Need help? Review these concept…
Order the general steps of transcription below 1 RNA reaches the end of the gene (hairpin loop forms or hits polyA tail) and unbinds from DNA 2 RNA polymerase binds to a gene promoter via transcription factors or other enzymes/proteins 3 RNA polymerase starts the RNA chain, adding new…
Select all that apply Which three of the following statements are true regarding the nuclear envelope of eukaryotic cells? It is continuous with the ER. It includes a perinuclear space. The outer side is studded with ribosomes. It is the location of the electron transport chain. It is composed…
The prenatal stage of pregnancy may also be called the ____ natal state of pregnancy. Prefixes: ab-, ad-, ana-, ante-, anti-, cata-, con-, contra-, hyper-, hypo-, infra-, inter-, intra-, macro-, micro-, para-, pre-, pro-, pros-, re-, retro-, syn-, sym- Blank 1 Blank 1 Add your answer
Part F (6 of 6) Emphysema can lead to which acid/base disturbance? What would be the compensation? metabolic acidosis; hypoventilation by the lungs respiratory alkalosis; kidneys will retain more H$^+$ and excrete HCO$_3^-$ respiratory acidosis; kidneys will retain more HCO$_3^-$ and excrete…
Question 1 0.5 pts Which two statements below apply to anabolic pathways involved in metabolism? Select both They release energy Their products are more complex compounds than the reactants used to create the products. They are dominated by exergonic reactions. They break down complex molecules…
Mc Graw Hill 35 of 138 Concepts completed Multiple Choice Question Babies are born with an immune system that _________ O has no ability to fight pathogens; that comes several months after birth O contains antibodies against all pathogens O can distinguish "self" from "foreign" antigens Need…
What is the primary role of the basal ganglia in motor control? A initiating muscle contractions directly through spinal motor neurons B coordinating balance and posture via feedback from the vestibular system C modulating movement initiation and suppression through excitatory and inhibitory…
Score: 0/450 Question V Which step does E3 of the pyruvate dehydrogenase complex catalyze? restoration of the oxidized form of a lipoyllysyl group transfer of two electrons and an acetyl group to the oxidized form attachment of coenzyme A to an acetyl group, forming acetyl-CoA oxidative…
6. The force of skeletal muscle contraction varies with all of the following EXCEPT: a. Amplitude of the muscle action potential b. Frequency of action potentials in the muscle fibers c. Average calcium concentration in the sarcoplasm d. Number of active actin-myosin force generating sites e.…
Which of the following best describes the focus of population health science? The risk factors that shape population-level access to resources and adequate health services The conditions that shape distributions of health across and within populations and individuals The genetic conditions that…
0 of 16 Concepts completed Multiple Choice Question In the context of the star model of organizational design, ______ refers to the forma O structure O style O strategy O function Need help? Review these concept resources. Read About the Concept Rate your confidence to submit your…
Part A (1 of 6) Starvation would cause which of the following acid-base conditions? Also, determine what type of compensation (metabolic or respiratory) there would be. metabolic alkalosis with respiratory compensation respiratory alkalosis with metabolic compensation metabolic acidosis with…
You inoculate a TSB broth with E. coli and incubate at 37C. How many bacterial cells are in the culture after 2 hours (generation time of 20 minutes in log phase)? Assume that the inoculum consisted of 1000 cells, and that cells were in log phase for the entire 2 hours.
Which of the following is TRUE of both Klinefelter syndrome and Turner syndrome? Both are the result of mitotic errors early in development. Both give rise to individuals who have external male genitalia. Both typically result from nondisjunction. It is the mechanism by which dizygotic, but not…
A 22-year-old presents with a sudden, severe headache accompanied by meningismus and vomiting. Emergent CT scan is negative. LP results reveal sample is positive for xanthochromia. What would be the most appropriate next step? O MRI scan with gadolinium O Admission and antibiotics O Hydration…
Food-borne intoxication is when... A You ingest live bacteria and they make you sick B You ingest endospores and they germinate in your stomach C You ingest the toxin that was produced by live bacteria in the food you ate before you ate it Last saved 9:15:33 PM Questions Filter (12)
23. Complete the following table: If necessary, you may put your answers below the table. Blood Group Antigens on red blood cells Antibodies in plasma Can receive blood from Can give blood to A A B Anti-A AB A and B O A and AB
What is a characteristic of the DNA that undergoes homologous recombina It is located on the ends of chromosomes. It is double stranded. It is located in the middle of chromosomes. It is nearly identical or completely identical in sequence. Need help on this question? Get a hint Show answer
Changes in environmental temperature may: Select one: a. Affect the fluidity of bacterial membranes b. Affect the motion of macromolecules within the bacterial cell c. Affect the stability of nucleotides and/or denature DNA within bacteria d. All of the above
2. The females of two species of fruit fly, Drosophila melanogaster and Drosophila simulans release slightly different mating hormones called pheromones, which are used to attract male mates. a. geographic isolation b. behavioral isolation c. temporal isolation 3. A type of isolation in which…
CHAPTER 1 LEARNING EXERCISES WHICH IS THE CORRECT MEDICAL TERM? ect the correct answer, and write it on the line provided. 1. The term ________________________________ describes the surgical repair of a nerve. neuralgia neurorrhaphy neurology neuroplasty 2. The term…
Why do you think the reaction times to individual colors were longer when presented with a mixed stimulus (Part 2E) vs a single color stimulus (Parts 2C and 2D)? Explain physiologically. Paragraph Lato (Recomm... B I U A 19px Average Reaction Time: 308.75 msec The average reaction time for…
Which option best defines a paraphyletic group? a. a group that does not include the common ancestor of all its members and does not contain every species that descended from that ancestor b. a group that includes the common ancestor of all its members and does not contain every species that…
Question 7 of 10 © Macmillan Learning Under appropriate conditions, hemoglobin dissociates into its four subunits. The isolated $\alpha$ subunit binds oxygen, but the $O_2$-saturation curve is hyperbolic rather than sigmoid. In addition, the binding of oxygen to the isolated $\alpha$ subunit is…
UNIT 6 REVI Name Section Date Check Your Understanding Critical Thinking and Application Questions 1 Explain how the structure of each of the following relates to its function. a Compact bone: b Spongy bone: c Long bone: 2 A bone tumor disrupts the normal structure of osteons, replacing the…
Metta always goes to her town's New Year's Day parade. While the weather is always cold, this year temperatures are lower than normal, and the windchill is -2°F. Metta bundles up because she doesn't want to miss the parade and ends up being outside for almost two hours. What impact does cold…
Adult Drosophila lays 50-100 eggs per day, and each contains a shell made of so-called chorion proteins. These specialized proteins need to be produced at a very high level, at a precisely specific stage of oogenesis. The genes encoding chorion genes are clustered together. As a way to increase…
Q4.28. African elephants are iteroparous species, reproducing repeatedly through their lifetimes. Females begin reproducing around age 10, and have a calf every 4 years or so. The natural mortality of adult elephants is very low (when poaching and human-mediated stressors are excluded), so…
Stereochemistry (6 Marks - 1 Mark per response) Ivermectin is an antibacterial and antiparasitic natural product that is produced by fermentation cultures of the bacteria Streptomyces avermectilis. It is an inexpensive and well-tolerated treatment for river blindness in humans caused by the…
A 22 year old woman complains of weakness and fatigue that is worse in the afternoon and during prolonged activity, but improved by rest. On physical exam, DTRs and sensation are normal. Which of the following is the likely pathogenesis of the disease? O prevention of the release of…
Albert's squirrel and the Kaibab squirrel are distinct subspecies that live on opposite sides of the Grand Canyon. They were once one species, but now differ significantly, including fur coloring. a. geographic isolation b. behavioral isolation c. temporal isolation Of the seven species of…
Which of the following sentences is true? Select one: a. If a bacterium's cell volume decreases after being placed in solution A, then solution A is thermotonic relative to the bacterium. b. If a bacterium's cell volume decreases after being placed in solution A, then solution A is hypertonic…
Question 3 of 14 Place the steps of eukaryotic DNA replication in order, from when a germ cell enters gap 1 ($G_1$) phase to the cell cycle termination. Attempt 2 Cell enters gap 1 The initiation complex creates an active replication fork as helicase unwinds DNA. Each genomic origin of…
23. Using the individual processes listed in the box to the right, determine which of the following re the proper order of events involved in a skeletal muscle contraction? You might want to write these out on a separate piece of paper. A. Binding sites on Actin are exposed B. Actin and Myosin…
In Drosophila, the genes for body color and wing length are found on the X chromosome. Gray bodies ($$y^+$$) are dominant to yellow bodies ($$y$$) and long wings ($$m^+$$) are dominant to miniature wings ($$m$$). A male fly with a gray body and miniature wings is crossed to a female with…
1. Cardiac pacemaker cells are extremely important for normal regulation of heart rhythm. These autorhythmic cells undergo spontaneous action potentials caused by pacemaker potentials. How do these cells spontaneously depolarize (i.e., what happens?). How do they generate an action potential?…
1 mitochondrion 2 nucleus 3 sarcoplasmic reticulum 4 muscle fiber 5 myofibril Match each of the options above to the items below. A ______ is an intracellular structure that contains enzymes used to convert the energy in food into fuel muscles can use. A ______ is an elongated cell that runs…
Sep 30 eclass.yorku.ca Quiz 4 - Opens... Pre-class prep... Home Dashboard My courses Time left 2:59:37 1 out of Some Aleutian Islands are surrounded by urchin barrens while others are surrounded by kelp forests. Which statement gives the primary explanation for these differences? Select one: a.…
10:17 Back Pharmacokinetics tut.docx Tutorial: pharmacokinetics Consider the following scenario: a drug has a first order elimination rate constant of $0.5hr^{-1}$ and an apparent distribution volume of 3 litres. You wish to maintain a patient's serum levels of this drug above a level of…
+95 possible +100 +100 +85 Which statements about myosin are true? During muscle contraction, thick and thin filaments slide past each other causing an overall lengthening of the muscle. The tail of the myosin molecule acts as a molecular lever and binds ATP. In a muscle cell, myosin tails…
Part A When discussing photosynthesis, some people mistakenly talk about the light reactions and the dark reactions. Why is "dark reactions" an inaccurate name for the Calvin cycle? View Available Hint(s) Both the light reactions and the Calvin cycle are dependent on light. This implies that…
Yvonne has one copy of a gene for an X-linked dominant disease. She is fortunate to have a very mild form of the disease, which suggests that in the relevant organs, the X chromosome containing the dominant disease allele is silenced by X inactivation. If she has children with a man who does…
© Macmillan Learning The dominance pattern of a gene can be determined from the phenotypes of the parents and offspring. In the examples below, assume that each parent is homozygous for the specific allele and that the progeny are heterozygous. Classify each example as either complete…
8-11e0-9572-0800200c9a66/33c331a2-0bb1-448f-9ec9-70b15c3dc190/... Resources Al Tuto Side-by-Side Fe-S Learning d You decided to investigate the oxidation state of Complex III in the presence of Dr. Hoo's inhibitor to distinguish between KCN and antimycin A. Knowing the oxidation state of…
Which option best defines a polyphyletic group? O a. a group that contains the common ancestor of its members and/or all descendants of that common ancestor O b. a group that does not contain the common ancestor of its members but does contain all descendants of that common ancestor O c. a…
/2100 Resources Hint Submit Answ Hide < Question 14 of 21 > Put the steps of GroEL-GroES chaperonin function in order, starting with an unfolded polypeptide and ending with a polypeptide in its native conformation. © Macmillan Learning Unfolded protein Folded protein Answer Bank ATP is…
As the percent lean of a meat product increases, so does the price. What can frugal consumers do to save money without compromising heart health? Multiple Choice Use regular ground beef when making tacos, but rinse the browned ground beef under warm water to remove the excess fat before…
My Course - Biochemistry-1 Protein stability interactions show the tertiary structure of hub/assessment/f188d950-dd73-11e0-9572-0800200c9a66/27fa2ad8-4363-4806-91f3-bd7921e35cbe/d262da07-afab-41 pts Question 4 of 10 A small generic section of the primary structure of an $\alpha$ helix is given…
You are investigating certain plant taxa in your neighborhood. You come across a plant that you are pretty sure is an angiosperm, but you are not certain without your handy field guide. Which of the following characters of the plant could you use to convince your neighbors that the plant is an…
Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus? a. A translation stop codon is added to the 3' end of the pre-mRNA. b. Sequences called introns are removed by spliceosomes. c. A polyA tail is added to the 3' end of the mRNA. d.…
Question 2 (Q002) Adaptations are permanent traits that may result from natural selection. temporary responses to physiological stress. the same as acclimatizations. reversible, short-term adjustments. Question 3 (Q003) What is the definition of hypoxia? condition in which the body is getting…
Question 7 2 pts Un suelo A-1 en la clasificación AASHTO es más adecuado para carreteras que un suelo A-7. True False Question 8 2 pts Los suelos con baja densidad relativa tienden a ser más estables en cimentaciones. True False Question 9 2 pts Las rocas sedimentarias se forman a partir de la…
5.00 Points Possible | Due Wednesday 10/01/25 at 9:00 AM Which of the following statements best describes the concept of epistasis? O The interaction between genes in which one gene masks or interferes with the expression of another. O Multiple genes working together to control a single…
If the statement is true, write True on the line. If the statement is false, write False on the line. 1.61. True An erythrocyte is commonly known as a red blood cell. 1.62. False Arteriomalacia is abnormal hardening of the walls of an artery or arteries. 1.63. A colostomy is the surgical…
2 Ch chegg - Search is part of the citric My Course - Introdu d950-dd73-11e0-9572-0800200c9a66/33c331a2-0bb1-448f-9ec9-70b15c3dc190/... Resources AI Tutor Side-by-Side ETC inhibitors rs you are looking ssium cyanide. ginning with er of electrons from quinone. Learning Considering the whole ETC…
Three-month-old Mary Jo can hold her head up when in the arms of an adult, but she doesn't yet have much control of what her legs do. Which one of the following best describes Mary Jo's progression in muscular control? A It shows a cephalocaudal trend, which is typical. B It shows a definite…
Q 3 - You are studying a gene that controls ossicone (horn) length in giraffes. The wild-type long- ossicone allele ($$L$$) is dominant to the mutant short-ossicone ($$l$$) allele. However, the $$L$$ allele is only 60% penetrant in both homozygotes and heterozygotes. In a population of giraffes…
Wrong answer Question 5 0 / 1 pts On the following diagram, assume two character states (- and +) for each character, and that + represents the derived state. Characters 1-5 change state in the positions indicated on the tree diagram. If you were to reconstruct the data matrix that yields the…
* Posterior root (what type of neuron is found there?) Sensor * Posterior root ganglion (what part of a neuron is clustered here?) * Anterior root (what type of neuron is found there?) motor, e * Posterior gray horn (what types of cell bodies are found there?) * Anterior gray horn (what types…
Several members of a family have polydactyly, and they differ in their numbers of extra fingers and toes. Yet, certain relatives who should have extra digits don't, such as Megan. Megan's father has an extra digit on each hand and foot, and she has two children, a son with two extra fingers and…
What are the four "PUBS" signs of possible alcohol overdose, as provided by the Gordie Center? Select one: Pulse is rapid; Unresponsive to pinch; Blurred vision; Skin is blue, cold or clammy. Puking while passed out; Unresponsive to pinch or shaking; Breathing is slow, shallow, or has…
Choose the correct statement about the difference in entry mechanisms between bacteriophages and animal viruses. Bacteriophages "push" their genomes inside the host cells leaving the capsid outside as a ghost. Only bacteriophages enter the host cells as an intact virion (genome+capsid). Animal…
TicToc Corp. is a manufacturer of smart watches that track the wearer's heart rate and sleep patterns. Which of the following is most likely an implication of new firms entering this industry? Multiple Choice The rivalry among existing competitors will reduce. The incumbent firms will spend…
Types of Strength Training (Keyboard Navigable Alternative Version) Match each type of training to its description. 1 Isometric (static) exercise 2 Dynamic exercise 3 Isokinetic exercise Match each of the options above to the items below. Exertion of muscle force through a joint's range of…
Which option best defines a monophyletic group? a. a group that consists of a common ancestor and all of its descendant species, but no other species b. a group that does not include the common ancestor and all of its descendant species c. a group that consists of a common ancestor and some of…
Part A Your teacher wants you to mix up the enzymes and substrates necessary to perform the Calvin cycle in a test tube. To control the reactions, you wish to do this in the absence of the light reactions, without whole chloroplasts, and with no cells present. What components do you need to put…
Mike is a 56 y/o male who lives in an abandoned building. With about 40 other street people. He comes to the clinic with a social worker who describes his symptoms as: a cough, dyspnea, pleuritic chest pain, fever and tachypnea. Your physical exam notes that he has some consolidation in the…
Part A Which of the following statements is true of the electron transport chain that follows photosystem I? View Available Hint(s) An electron that will be absorbed by a primary electron acceptor is energized. Water is split into oxygen and hydrogen ions. Hydrogen is pumped across its…
Which of the following statements best describes the location of the water molecules in the crystal structure of the DNA doubl helix? [Hint: make the water molecules visible and color the DNA atoms and bonds gray.] Water is equally distributed in the interior and exterior of the double…
In a hypotonic solution, an animal cell will neither gain nor lose water. shrivel. experience turgor. lyse. Question 7 (1 point) Listen Facilitated diffusion across a biological membrane requires _______ and moves a substance _______ its concentration gradient. energy and transport proteins;…
Types of Workouts (Keyboard Navigable Alternative Version) Match each type of workout to its description. 1 upper- and lower- body split workout 2 Total body workout 3 Muscle group split workout Match each of the options above to the items below. A general-fitness workout targeting multiple…
Some of the enzymes involved in DNA replication participate in DNA repair, which is not surprising given that both processes involve the same DNA molecule. In the spaces provide, compare and contrast the process of DNA replication with the process of DNA repair. DNA Replication DNA Repair…
A patient is admitted with flaccid weakness of the arms and lower legs. There is a one week history of burning sensation and weakness occurring in the lower limbs that later progressed to the arms. On examination, there is a loss of deep tendon reflexes bilaterally. The patient also states he…
Part A A coleus plant has variegated leaves showing a variety of pigments. If this plant has a high percentage of leaf coverage that appears yellow and orange mottled among the green portions of the leaf, what type of pigments would be associated with the yellow and orange sections of the…
6 Which of the following statements describes how thromboembolism affects stroke patients? A) Venous thromboembolism (VTE) is difficult to diagnose in older patients, in part due to reduced sensitivity in patients B) VTE is an uncommon problem in stroke patients whereas symptomatic…
The distinction between complex and polygenic traits is that Multiple Choice polygenic traits are caused by more than one gene, and complex traits are caused by only one gene polygenic traits are caused by more than one gene, and complex traits are caused by one or more genes as well as…
Chrome File Edit View History Bookmarks Profiles Tab Window Help myfsu Po Mail - Mi Sherpath Elsevier A eaqng.elsevier.com... Relaunch to update perdue owl apa cit... purpose game to h... Science - OpenStax All Bookmarks Quit Report content err Study mode ON Question 36 of 50 Which arterial…
Which option best defines bootstrap resampling? a. a statistical technique for quantifying how strongly a data set supports a given phylogenetic relationship b. a statistical technique for quantifying how strongly a phylogenetic tree matches the true evolutionary relationships c. a statistical…
What 3 things should a salesperson confirm when selling an appointment? O location of office, reason for appointment, time needed for call O specific reason for appointment, amount of time needed, and specific time to meet O location of office, amount of time needed and specific time to meet O…
5.00 Points Possible | Due Wednesday 10/01/25 at 9:00 AM Which of the following statements about the rabbit coat color alleles is true? O The Himalayan allele is recessive to all other alleles. O The albino allele is dominant over all other alleles. O The wild-type allele is dominant over…
6 Multiple Choice 2 points Which of the following is NOT true about the lagging strand? Utilizes Okazaki fragments that are later linked with enzyme New DNA on this strand is being synthesized in a 3' to 5' dire Synthesis is in short segments as DNA unwinds Replication is discontinuous on this…
Categorize each rate based on whether it would increase or decrease in the presence of a membrane uncoupling agent. Note: Please read through the entire solution for the conclusion of this case. Increase Decrease Answer Bank rate of glycolysis rate of pyruvate utilization by the PDH…
The difference in mode of inheritance between Huntington disease and cystic fibrosis is that Multiple Choice A person with Huntington disease can have unaffected parents, but a person with cystic fibrosis must have an affected parent Huntington disease does not skip generations, but cystic…
Which rationale is correct regarding administration of Rho(D) immune globulin to the mother immediately after delivery after review of the blood test results of a postpartum patient and the neonate? O The neonate and the mother are Rh positive. O The neonate and the mother are Rh negative. O…
2. The per capita growth rate of country Y in the year 2024 was 5%. If the population size of country Y was 10 million at the beginning of 2024, what was the final population size at the end of 2024? Note: Per Capita Population Growth Rate = (Final Pop. Size - Initial Pop. Size) divided by…
A recent GWAS study looked for SNPs associated with bipolar disorder. There were two groups of study participants, those who had bipolar disorder, and those who did not. Aside from this difference, the people in the groups were chosen to be as similar as possible with regards to things like…
Question 27 A 9-year-old boy receives the chickenpox (varicella) vaccine. Two years later, he is exposed to a classmate with chickenpox but does not get sick. Which adaptive immune process best explains his protection? O Memory B and T cells responded quickly to the virus O Innate immunity…
Part A Which event in the sequence of photosynthesis occurs before all the others in the list? View Available Hint(s) Carbon dioxide is converted into sugar. Oxygen is produced. Photons of light stimulate pigments within the thylakoid membrane inside of a chloroplast. Energy carrier molecules…
Which of the following is not involved in establishing lysogeny for phage lambda? O Rolling-circle replication generates multiple genomes in tandem, which are eventually cleaved by the enzyme terminase. O Lambda phage DNA integrates as a prophage in the host genome. O Once integrated in the…
Part C (3 of 5) - Follicular phase and the surge of estrogens 3 tries left Secretion of large amounts of estrogens by the dominant follicle directly and indirectly leads to which of the following? Select all that apply. A surge in LH release Increased release of GnRH Initiates a positive…
You have made nutrient-rich (aka rich) Saccharomyces media. Which of the following statements is true about this media? No strains will ever grow on this media. All strains can grow on this media. Only strains that are auxotrophs for all nutrients can grow on this media. Only strains that are…
Part A In the autumn, plants break down their chlorophyll, and leaves reveal some of their accessory pigments. Oaks, for instance, may reveal yellow to orange pigments that have always been there but are only revealed when chlorophylls are not prominent. Which wavelengths of light in the…
When $$Ca^{2+}$$ binds to calmodulin, a large conformational change in calmodulin's EF hands occurs. This conformational change exposes hydrophobic residues on the protein's surface. How might this structural change help to propagate the calcium signal? by allowing calmodulin to bind to other…
Question 7 of 21 Consider that electrons will back up in the chain and accumulate at all steps before the blocked step. Remember that there are two pathways for electrons to enter the ETC, and these pathways converge with the transfer of electrons from ubiquinone to Complex III. Besides…
Out in the open ocean (pelagic zone), the regions are described by the amount of light they receive. Match the zone with its description. aphotic zone euphotic zone disphotic zone [ Choose ] dark - light cannot penetrate to this zone this zone has light, and photosynthesis occurs here also…
- Academy - FIN 350 - Phase 1.xlsx - iso-20241231 - Sign in - Ctrl K - Catalog - What would you like to learn? - Question 8 of 60 - Time remaining: 02:56:40 - True or false: If neither variation in an A/B is statistically better, you pick the variation you like best and proceed to make the…
Glucose polymerizes to form cellulose, starch, and glycogen. Which of the following is true? O Cellulose is the most stable of the three. O In cellulose and starch, glucoses are connected with beta-1,4 linkages, while glycogen uses alpha-1,4 linkages. O Digestion of starch requires the…
Claude Bernard's use of curare and John Langley's use of nicotine: damaged the fibers of skeletal muscle, so that it could not contract. indicated that a chemical transmitter released from nerve cells had an effect on skeletal muscle cells. proved that an electrical impulse passed from nerve to…
Question 38 A 6-year-old girl develops hives, swelling around her lips, and difficulty breathing within minutes of eating a peanut butter cookie. Which alteration in immunity is most likely responsible for her reaction? O Type I hypersensitivity involving IgE and mast cell degranulation O Type…
Question 3 Complete the sequences below describing the movement of H+ and electrons during oxidative phosphorylation. Path of H+ flow. 1. Removed from NADH or FADH₂ 2. Through Complex 3. Through ubiquinone 4. Through Complex 5. Through cytochrome c 6. Through Complex IV 7. Bonds from O2 to form…
In the third quadrant of your streak for isolation, you see two different colony morphologies: one is yellow, round, convex, with entire margins, and the other is white, umbonate, with lobate margins. Which of the following is the best explanation. a) You forgot to flame your loop between…
NAME 1. A heptapeptide when treated with trypsin produced two peptides with the following composition: (Separation by commas indicates an unknown sequence) 1. Asp, Gly, Tyr 2. Lys, Phe, Val, Ala When the heptapeptide was treated with chymotrypsin, three peptides were produced: 3. Lys, Tyr,…
4. A 29 year old male falls 17 feet (5 m) to the ground from a tree. He complains of pain with movement and pain on the right side of his chest when he breathes. You note accessory muscle use, focal tenderness, bony crepitus, and absent breath sounds on his right side. What should you…
AMD is an age-related disease, as are several other common eye diseases. Which dietary food categories exacerbate (increase or promote) the risk and severity of AMD? A) Fried foods B) Processed foods C) High-sugar foods (added processed sugars such as sucrose, glucose, fructose) D) Meats with…
Karen and Anika are owners of a new personal assistant service called Assist You 2. They live in an area populated by single professionals, small local business owners, retired senior citizens, and families with little kids. For Karen and Anika, each of these groups, or segments, is a…
Question 17 1 pts Which weight categories are associated with a higher risk of early deaths? Underweight and obese Overweight and obese Underweight Underweight, overweight, and obese Question 18 1 pts Jahzara is studying for a nutrition quiz on energy expenditure and is reviewing factors that…
G1/S checkpoint G2/M checkpoint Spindle-assembly checkpoint maintains cell until necessary enzymes for replication are synthesized detection of DNA damage after replication ensures that each chromosome is attached to spindle fibers from opposite poles Answer Bank What are…
The lambda genome is replicated by a rolling-circle mechanism. What is the result after a round of replication? O a concatemer (i.e., multiple genomes joined end to tail, which are cleaved by a terminase), producing linear double-stranded DNA prior to packaging O several circular molecules…
QUESTION 1 OF 10 Why do groups haze? CHOOSE AN OPTION BELOW It's tradition. Some may view hazing behavior necessary to bond. The idea of going through an initiation fulfills a basic need, and individuals seeking to be part of a group are sometimes willing to haze, regardless of the…
2025 Fall Term A Home Announcements Assignments Grades Modules CU Book Access People Syllabus Zoom Lecture Recordings Lecture Recordings Question 2 1 pts +1 START A: 5'-GGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGTATGCAAGGGGCGAGGA B: 3'-CCAAATCACTTGGCAGTCTAGGCGATCGCGATGGCCAGCGGTGG…
Question 33 A 72-year-old patient is recovering from hip surgery and develops pneumonia after 5 days in the hospital. The nurse explains that this type of infection is especially concerning because: O Iatrogenic infections are often caused by antibiotic-resistant organisms O It is considered a…
Answer By discussing chromosomal mutations, I mentioned that it appears that the human Chromosome 2 is the result of two separate chromosomes present in an ancestral species. Chimpanzees and bonobos, our closing living relatives, have the ancestral condition of having 24 (not 23) pairs of…
Some combinations of recessive alleles cause problems so severe that a fetus may cease to develop. Such lethal allele combinations appear to alter Mendelian ratios because Multiple Choice homozygotes for the lethal allele pass it on to half their offspring. homozygotes for the lethal allele do…
Increased cardiac output and myocyte loss. Question 2 (2.5 points) Which of the following best explains the pathophysiological mechanism responsible for the patient's pulmonary crackles and shortness of breath? Increased right ventricular preload causing pulmonary artery hypertension Left…
Hershey's sustainability strategy is focused on protecting the company's investment in its product for many years to come by all of the following except Multiple Choice maximizing quarterly profits. having a long term view cocoa farming is seen as a great livelihood ensuring that the…
What is not a principle of cancer chemotherapy? Drug kills a constant proportion of tumor cells rather than a constant number Adverse effects are decreased by giving combinations of drugs with different side-effects Combining drugs with different mechanisms is more effective Cure does not…
5 Multiple Choice 2 points Social determinants of health (SDOH) contribute to a wide variety of health disparities amongst different population groups. SDOH could be best described as: Someone's personal desire to improve their own health. How someone's family convinces them to take action…
Part A Where is the most energy used in the Calvin cycle? View Available Hint(s) in the fixation of $$CO_2$$ to RuBP in the linkage of two G3P molecules together to form glucose in the regeneration of RuBP in the conversion of PGA to G3P in the rearrangement of the six-carbon molecule made from…
Sam is a 19 y/o male who comes to the clinic with a chief complaint of several weeks of fatigue and non-productive paroxysmal coughing. He initially had a sore throat, some rhiniti and low-grade fever Potential organisms that might have caused Sam's condition include which of the following: O…
Regina's pregnant sister is interested in boosting her intake of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), two omega-3 fatty acids that can be made from alpha-linolenic acid. She has heard that EPA and DHA are important for cancer prevention, brain health, cardiovascular…
The idea that femaleness is simply what happens when an embryo does not develop as a male is no longer supported by evidence because of the discovery of Multiple Choice the SRY gene in females gene that suppress all of the genes on a female's Y chromosome hormones that suppress expression of…
Q 4. Which of the following is the best definition of cellular respiration? the complete oxidation of glucose to CO2 and H2O a sequence of redox reactions with O2 as the final electron acceptor a sequence of redox reactions with the final electron acceptor from the environment a method of…
to Psychology / Benchmark 5: Checkpoint 12-14 page Time left 0:54:47 During the stage of resistance, what happens to the body when faced with a persistent stressor? Select one: O a. The body experiences chronic fatigue. O b. The body enters a state of relaxation. O c. The body adapts by…
Multiple Choice Some human disorders are caused by the presence of an entire extra chromosome. In these cases, instead of having 2 of a certain chromosome in each cell, the individual may have 3 of that chromosome in each cell. What genetic test would be most useful in determining if an…
a complex carbohydrate like cellulose Question 2 (1 point) Saved Listen Why does ADP have less potential energy than ATP? because ADP has only one phosphate group because ADP has only two phosphate groups because ATP has ribose as a sugar because ATP has adenine in it Question 3 (1…
Question 5 Which statement made by a patient attending an educational session indicates understanding regarding the structure and function of the male reproductive system? "The prepuce is the smooth end of the penis." "Surgical removal of the foreskin is called circumcision." "The proximal end…
According to the concept of endpoint control, voluntary reaching movements to a location in space A are planned based on the desired distance from its starting point. B are planned based on its desired final location. C require sensory feedback that arrives after an effector has been moved to…
Which of the following best exemplifies the term gender? Select the best answer. 1) Shakayla loves hanging out with her lady friends and talking about fashion. 2) Terrance was born with genitalia that are not clearly male or female. 3) Eric has the typical hormone levels of a male and the…
6. The barred pattern of chicken feathers is inherited by an X-linked gene. The dominant allele, $$X^B$$, causes barring and the recessive allele, $$X^b$$, causes no bars. In poultry, females are XY and males are XX. a) A non-barred rooster is crossed with a barred hen. What are the genotypes…
Select the true statements about denaturation. A zymogen is a denatured form of a proteolytic enzyme. Denaturation and digestion refer to the same process. Egg white meringue contains denatured egg white proteins. Protein denaturation involves cleavage of its peptide bonds. Denaturation of an…
Dichlore Logout Nearpod Fraction Untitled preferen ware.visiblebody.com/courses/136879/assignments/13222525/launch?activity_index=0&a=13222525&j=%0E%08%03%07 Canvas Nearpod VB Visible Body Webassign Instructor: Jacob Maxson Email: jamaxson@gmail.com Previous Activity 16 of 16 ice ed 7. What is…
Question 5 7 pts Which one of the following statements is false? Conductors have low resistivity and insulators have high resistivity. Resistivity does not depend on temperature of the material. Resistivity is a function of temperature. The resistance R of a wire with length L, cross-sectional…
1 Point Building off of work in animals on central pattern generators, epidural stimulation in humans can improve locomotion in paralysis patients by A stimulating the muscles impacted by spinal cord damage. B stimulating the muscles at a frequency related to the locomotion cycle. C providing…
Which of the following describes the cervical enlargement? A large area of spinal cord gray matter needed to innervate the upper extremities A large area of spinal cord white matter needed to innervate the lower extremities A large area of spinal cord gray matter that houses autonomic motor…
Which of the following is a correct ordering of the listed compounds from highest phosphoryl-transfer potential (most favorable delta G of hydrolysis) to lowest phosphoryl-transfer potential (least favorable delta G of hydrolysis)? O ATP, 1,3-Bisphosphoglycerate, phosphoenolpyruvate, glycerol…
Choose the sentence that uses verb forms correctly. Choose one answer. If I had a disease with the symptoms of streptococcus A, I would visit a doctor immediately. If I had a disease with the symptoms of streptococcus A, I will visit a doctor immediately. If I have a disease with the symptoms…
Question 3 0.5 pts It is important to add the activated charcoal to the cool solution before heating. It should not be added to a boiling solution because... It can cause the solution to foam up and boil over. It can spit and result in burn hazards. It can result in low sample recovery. All of…
Part D (4 of 6) A patient is admitted to the hospital with the following plasma values: pH = 7.2, Pco2 = 25 mmHg, and HCO3 = 18 mEq/L. What is the acid base imbalance? O metabolic acidosis with no compensation O metabolic acidosis with respiratory compensation O metabolic alkalosis with…
234/300 Eukaryotic DNA replication is different from prokaryotic DNA replication in all of these ways EXCEPT unlike prokaryotes, eukaryotes typically have multiple origins of replication. nucleosome assembly must immediately follow DNA replication in eukaryotes whereas this is unnecessary in…
Inside eukaryotic cells, misfolded proteins within the secretory pathway can be recycled by a quality-assurance mechanism. Arrange the steps in this process in their correct chronological order with the earliest step at the top. Instructions Ubiquitin is attached to defective protein. The…
Academy FIN 350 - Phase 1.xlsx fin-20341231 Sign in MKT Catalog What would you like to learn? Question 36 of 60 Time remaining: 02:37:16 Checking for statistical significance when testing a new marketing channel ensures: You developed a strong hypothesis. You've chosen the correct KPIs. You…
Paragraph Q4.3- Explain in molecular terms how binding of $$O_2$$ to $$Fe^{2+}$$ in hemoglobin causes a protein conformational change resulting in a 1 Å tilt in the F helix. Be specific. Describe three conditions that explain why hemoglobin is fully saturated with $$O_2$$ in the lungs and how…
Part A What is the role of $$O_2$$ in photosynthesis? View Available Hint(s) $$O_2$$ is a product of the light reactions. $$O_2$$ is a reactant in the light reactions. $$O_2$$ is a reactant in the Calvin cycle. $$O_2$$ is a product in the Calvin cycle. $$O_2$$ is a both a reactant and a product…
Write the correct answer in the middle column. Definition Correct Answer Possible Answers 1.26. white blood cell acute 1.27. prediction of the probable course and outcome of a disorder edema 1.28. swelling caused by an abnormal accumulation of fluid in cells, tissues, or cavities of the…
9 How do researchers in the metagenomics sector operate? 01:02:32 Multiple Choice They collect and sequence DNA, then consult databases of known genomes to imagine what the organisms to which the DNA belongs might be like. They study Mendelian traits in children. They link diseases by shared…
Carrie, 18, tries to get 7 - 8 hours of sleep per night, but she still has trouble waking up in the morning, and she feels drowsy during her afternoon classes. What might be the problem? Carrie is not getting enough sleep Carrie needs to take melatonin supplements Carrie needs to wake up…
19 of 33 Concepts completed Multiple Select Question Select all that apply Which of the following statements are true of cumulative preferred dividends? (Select all that apply) Preferred shareholders receive no interest on the cumulated dividends. Directors elected by common shareholders cannot…
Clear my selection 7 Multiple Choice 2 points Which statement about primase is true? It adds a ribonucleotide to the 3' end of a growing RNA molecule It reads template DNA 5' to 3' It separates bonds between nucleotides during DNA replication It adds RNA bases that provide a free 3'-OH group…
Extension Questions Question 1 Many microbe species, including the yeast from this experiment, are facultative anaerobes that can metabolize sugars by both aerobic respiration and by fermentation. Apply your knowledge of these processes and yeast metabolism to suggest the optimal growing…
Multiple Choice 2 points Which of the following is NOT an important feature of DNA replication? It proceeds in a 5' to 3' direction DNA replication is semiconservative All of the above are important features of DNA replication There are multiple origins of replication along a linear…
A 60-year-old male with a history of moderately chronic severe COPD has recently weaned off a long course of corticosteroids. He presents now with headaches that are worse with straining. He also complains of double vision and blurriness. What is most likely to be found on physical exam? O…
Question 3 Which of the following statements is incorrect? O DNA methylation would lead to open chromatin and gene activation. O Histone acetylation would lead to open chromatin and gene activation. O DNA methylation occurs on the cytosine nucleotide. O Histone methylation occurs on the Lysine…
Psychology / Benchmark 4: Checkpoints 9-11 / Benchmark 4: Checkpoints 9-11 What is the primary function of the trillions of synapses that form in a baby's brain during infancy? O a. To control muscle movement O b. To create a complex neural network for future learning O c. To store memories O…
What was the most common pattern for an adult to come to stand? Upper extremity reach, symmetrical push, forward head neck, and trunk flexion, and a symmetrical squat Symmetrical push and reach followed by half kneel Upper extremity reach, asymmetrical push, forward head neck and trunk flexion…
If plants were no longer able to perform the light reactions and they could only utilize the Calvin cycle, which of the following wo be true? Check All That Apply Plants would not produce oxygen. G3P would be produced in much smaller quantities. NADPH production would decrease while ATP…
Chrome File Edit View History Bookmarks Profiles Tab Window Help myfsu Por Mail - Mi Sherpath Elsevier A eaqng.elsevier.com... Relaunch to updat perdue owl apa cit... purpose game to h... Science - OpenStax All Bookm X Report content error Study mode Quit Question 29 of 50 Which percentage of…
1. Peptone A. refers to a hydrolysis of carbohydrates used in growth media. B. refers to a hydrolysis of proteins used in growth media. C. consists of a water extract of beef. D. consists of a mix of monosaccharides and oligosaccharides. E. refers to a hydrolysis of proteins used in growth…
Estes and his colleagues speculate that the decline in otters during the 1990s was due to a(n) _____. Select one: O a. infection by hantavirus. O b. sudden increase in the numbers of urchins. O c. switch in the predation patterns of killer whales (orcas) to include more otters. O d. decrease in…
BACTERIAL GENETICS • BACTERIAL TRANSFORMATION INTRODUCTION LABORATORY SIMULATION Match the inoculated agar plates with their expected growth after incubation. -pGLO on LB/amp Choose match +pGLO on LB/amp/ara Choose match +pGLO on LB/amp Choose match -pGLO on LB Choose match What steps were…
Which statement about the actions of aldosterone in regulating water and electrolyte balance is correct? Select all that apply. One, some, or all responses may be correct. Secreted when blood pressure is low Decreases renal reabsorption of sodium Increases renal reabsorption of…
Question 17 (1 point) What is the concept of "body doubling" in the context of work? A strategy for increasing physical exercise during work hours A way to conduct multiple tasks simultaneously for better efficiency A method of working in complete isolation to maximize focus A technique that…
Question 22 Leilani's RDA for mineral 'Y' is 50 micrograms/day. Would mineral 'Y' be considered a minor/trace mineral? O No, because the RDA is less than 100 milligrams/day. O No, because the RDA is less than 100 micrograms/day. O Yes, because the RDA is less than 100 micrograms/day. O Yes,…
Which ventilation-perfusion information is relevant for understanding atelectasis and pulmonary edema? Select all that apply. One, some, or all responses may be correct. The ventilation-perfusion ratio will be low. Shunting will occur. Alveolar dead space will be increased. The pulmonary…
Please match the following structure and function. brain stem Gateway to the cerebral cort Cerebellum Control movement; found de Thalamus Attention, perception,proces Cerebral cortex Control movement; found de Corpus callosum Connecting the two hemisphs Hippocampus Learning and…
dysfunction Question 3 (2.5 points) What is the most likely pathophysiological cause of the patient's jugular venous distension and bilateral pitting edema? Left ventricular failure causing increased systemic venous return Severe mitral regurgitation causing left atrial volume overload Right…
According to the Spencer-Bain principle, __________. intelligence comes from sensory acuity smaller populations are more exposed to evolutionary pressures the probability of a behavior is increased if it is followed with a pleasurable outcome and decreased if it is followed by painful…
A mutation in RNA polymerase III would likely result in which of these consequences? There would remain an abundance of RNA components in the nucleus. Amino acids will fail to attach during the elongation phase of transcription. The cell would no longer be regulated in its gene expression. The…
Canvas Question 48 In a type IV delayed hypersensitivity reaction how will you know you have been exposed to an antigen? O Your body undergoes a normal immune response O You will cough and have a fever O You will see a skin reaction with the second exposure O You will not know you have been…
16. The transcriptionist recognized the name of a patient as that of the son of a friend of hers. The report indicated a good prognosis for the child. Because the mother had been depressed and uneasy for her child, the transcriptionist felt it was all right to telephone her and reassure…
What is the link between aspartame and cancer? Aspartame has not been approved by the FDA, so there is no way to assess cancer risk. A study showed that aspartame causes bladder cancer in rats. Aspartame has been linked to multiple kinds of cancer. There is no known, consistent association…
Question 2 2 pts You would like to offer a service to the researchers in your institution for identification and quantitative analysis of proteins produced by microorganisms in liquid media using your HPLC-mass spectrometer system. Which one of the ionization techniques is best suited for this…
Question 10 Which statement by a participant in an educational session indicates understanding about expected findings in the reproductive system? "Vaginal pH is normally alkaline." "The wall of the vagina becomes rougher during menopause." "Ovarian hormones control the amount of fluid in the…
Which pathophysiology statement reflects understanding of a client's diagnosis of Goodpasture syndrome? Antigen-specific immunoglobulin E (IgE) binds to the surface of basophils and mast cells. Autoantibodies attack the glomerular basement membrane of the kidney. Rapid and systemic reactions of…
When excess nutrients such as nitrogen and phosphorus, from fertilized fields runs into a stream, the stream becomes eutrophic, or overly nutrient rich. Such eutrophication may lead to: Select one: a. Decreased levels of phosphate b. Decreased levels of nitrogen c. Decreased microbial diversity…
1 Multiple Answer 10 points Select all of the following that would be an example of movement in the human body. formation of a new organism from a parent organism an increase in body size air coming into and out of the lungs red blood cells going from the heart to the capillary in your typing…
SIRS (systemic inflammatory response syndrome) is defined as: A. The body's response to low fluid volume manifested by altered perfusion and shock B. The body's response to a variety of nonspecific insults manifested by altered mental status, elevated heart rate (tachycardia) C. The body's…
Polling How can ecological disturbance, such as habitat loss, contribute to the outbreak of a new viral disease in humans? A. Disturbances bring humans and reservoir hosts together in new ways. B. Ecological disturbances increase the rate of mutations. C. Viruses would respond by mutating to…
Question 37 of 42 Which statement accurately describes the relationship between cor pulmonale and heart disease? Left-ventricular failure causes pulmonary venous congestion and pulmonary edema. Impaired ventilation causes decreased oxygenation, which precipitates cardiac…
Match the following terms to their definitions hyphae that have hundreds or thousands of nuclei in a continuous mass specialized hyphae found on mycorrhizae reproductive elements in fungi that are spread by wind or water network of hyphae that infiltrate a food source reproductive…
Which of the following statements is true about the promoter of a protein-coding gene? a. The promoter is a non-transcribed region of a gene. b. The promoter is part of the RNA molecule. c. The promoter is a site at which only RNA polymerase can bind. d. The promoter is a site found on RNA…
Part A The mass extinction of dinosaurs after a giant asteroid collided with the earth 66 million years ago was linked to a massive decline in plant life. What critical input for photosynthesis was dramatically reduced after the asteroid impact and resulting fires? View Available…
© Macmillan Learning Match each description to the term it defines. Gene Allele Chromosome Answer Bank an alternative forms of a particular gene a chromosomal region that codes for a functional transcript a functional unit of heredity threadlike DNA molecules that are visible during…
Elsevier Adaptive Quizzing Elsevier Adaptive Quizzing Elsevier Adaptive Quizzing Report con Question 27 Which underlying premise is part of the stepwise approach for asthma control? Daily exercise improves oxygenation. Balance diet, exercise, and drugs. Increase or decrease drugs until a…
Which of the following statements is incorrect? Folic acid in food can serve as methyl-group donor for both histone and DNA methylation. Epigenome is dynamic and responds to environmental changes. Enzymes that catalyze DNA methylation can also catalyze histone methylation. For genes that are…
0 of 50 Concepts completed Multiple Choice Question The tube that receives sperm from the epididymis is called the _blank_. perineum gonad ductus deferens seminal vesicle Need help? Review these concept resources. Rate your confidence to submit your answer. High Medium Low © 2025 McGraw Hill.…
Select the correct answer, and write it on the line provided. 1.21. The term _________________________ describes any pathologic change or disease in the spinal cord. myelopathy myopathy pyelitis pyrosis 1.22. The medical term for higher-than-normal blood pressure is…
Question 3 1 pts From the reading: The endocrine function of adipose tissues in health and cardiometabolic disease During periods of calorie surplus, how does white adipose tissue expand? Increasing number of adipocytes (hyperplasia) Increasing size of adipocytes (hypertrophy) Transforming into…
(Select all that apply) Which of the following is/are true about active transport? It uses energy obtained from the breakdown of ATP. It uses transmembrane proteins that are capable of changing shape. The transport can happen against concentration gradient. It transports large, polar…
What molecule has Emily's Planner Mail - Emily Rezen Identify practical s 60637 New Chrome availa 12:35 Time Remaining Return Next 22/25 22 Multiple Answer 1 point Select the stages of the cell cycle during which each chromosome consists of two chromatids joined at the…
Aerobes may tolerate the presence of oxygen because they have one of several enzymes that can detoxify toxic oxygen by-products such as hydrogen peroxide or superoxide. One such enzyme is superoxide dismutase. Another one that we learned about in lab is: Select one: a. DNA gyrase b. RNA…
A 22-year-old female presents to the ED with complaints of severe muscle weakness after any exercise. She also complains of drooping eyelids and diplopia that worsens throughout the day. Sensation and deep tendon reflexes are normal. Which of the following diagnosis is most appropriate? O…
Question 45 1 P Four patients in labour all request epidural analgesia to manage their pain at the same time. Which ethical principle is compromised when only one anesthetist is on call? A Beneficence B Nonmaleficence C Justice D Autonomy Last saved 12:12:55 PM Questions Filter (50) K First <…
Question 15 A nurse knows that the key characteristic of an opportunistic infection is: O It only occurs in individuals with weakened immune systems. O It can be treated with any available antimicrobial agent. O It is transmitted through direct contact with an infected individual. O It is…
Nearpod VB Visible Body Webassign Instructor: Jacob Maxson Email: jamaxson@gmail.com < Previous Activity 16 of 16 5. In a long bone, yellow bone marrow is found in the and red bone marrow is found in the a. Compact bone, trabeculae b. Medullary cavity, spongy bone c. Central canal, medullary…
Question 2 4 Points Some endurance athletes use wearable sensors while training to monitor muscle oxygen saturation ($$SMO_2$$). Suppose an athlete's wearable sensor gives $$SMO_2$$ readings that are always 10% lower than the athlete's actual muscle oxygen saturation. Measurements taken with…
Which of the following are true regarding upper motor neurons? The neurons in primary motor cortex are upper motor neurons Damage to upper motor neurons may result in dysarthria Upper motor neurons are the motor neurons that are connected to the facial muscles that move during speech. a &…
rep Part A What is the purpose of a cuticle on a leaf? View Available Hint(s) to bring in more light to carry sugar down to the roots to prevent water loss to perform photosynthesis to allow CO2 to enter the cell to carry water to the rest of the leaf Submit Provide Feedback
Question 20 of 20 00:06 HR MIN SEC Submit All © Macmillan Learning An organism's inherited traits that increase its likelihood to reproduce and survive are the traits it will most likely pass on to the generations that follow. This pattern can be explained by the principle of: O…
Select all of the following that describe logistic population growth. Check All That Apply Population growth slows as resources become limited. The larger the population size, the faster it grows. Population size stabilizes at the carrying capacity. An explosive growth period continues because…
10 of 33 Concepts completed Multiple Select Question Select all that apply Which of the following ratios might be used to estimate the value of a stock? (More than one answer may be correct) the price-earnings ratio the book-to-value ratio the price-sales ratio Need help? Review these concept…
Order the general steps of transcription below 1 RNA reaches the end of the gene (hairpin loop forms or hits polyA tail) and unbinds from DNA 2 RNA polymerase binds to a gene promoter via transcription factors or other enzymes/proteins 3 RNA polymerase starts the RNA chain, adding new…
Select all that apply Which three of the following statements are true regarding the nuclear envelope of eukaryotic cells? It is continuous with the ER. It includes a perinuclear space. The outer side is studded with ribosomes. It is the location of the electron transport chain. It is composed…
The prenatal stage of pregnancy may also be called the ____ natal state of pregnancy. Prefixes: ab-, ad-, ana-, ante-, anti-, cata-, con-, contra-, hyper-, hypo-, infra-, inter-, intra-, macro-, micro-, para-, pre-, pro-, pros-, re-, retro-, syn-, sym- Blank 1 Blank 1 Add your answer
Part F (6 of 6) Emphysema can lead to which acid/base disturbance? What would be the compensation? metabolic acidosis; hypoventilation by the lungs respiratory alkalosis; kidneys will retain more H$^+$ and excrete HCO$_3^-$ respiratory acidosis; kidneys will retain more HCO$_3^-$ and excrete…
Question 1 0.5 pts Which two statements below apply to anabolic pathways involved in metabolism? Select both They release energy Their products are more complex compounds than the reactants used to create the products. They are dominated by exergonic reactions. They break down complex molecules…
Mc Graw Hill 35 of 138 Concepts completed Multiple Choice Question Babies are born with an immune system that _________ O has no ability to fight pathogens; that comes several months after birth O contains antibodies against all pathogens O can distinguish "self" from "foreign" antigens Need…
What is the primary role of the basal ganglia in motor control? A initiating muscle contractions directly through spinal motor neurons B coordinating balance and posture via feedback from the vestibular system C modulating movement initiation and suppression through excitatory and inhibitory…
Score: 0/450 Question V Which step does E3 of the pyruvate dehydrogenase complex catalyze? restoration of the oxidized form of a lipoyllysyl group transfer of two electrons and an acetyl group to the oxidized form attachment of coenzyme A to an acetyl group, forming acetyl-CoA oxidative…
6. The force of skeletal muscle contraction varies with all of the following EXCEPT: a. Amplitude of the muscle action potential b. Frequency of action potentials in the muscle fibers c. Average calcium concentration in the sarcoplasm d. Number of active actin-myosin force generating sites e.…
Which of the following best describes the focus of population health science? The risk factors that shape population-level access to resources and adequate health services The conditions that shape distributions of health across and within populations and individuals The genetic conditions that…
0 of 16 Concepts completed Multiple Choice Question In the context of the star model of organizational design, ______ refers to the forma O structure O style O strategy O function Need help? Review these concept resources. Read About the Concept Rate your confidence to submit your…
Part A (1 of 6) Starvation would cause which of the following acid-base conditions? Also, determine what type of compensation (metabolic or respiratory) there would be. metabolic alkalosis with respiratory compensation respiratory alkalosis with metabolic compensation metabolic acidosis with…
You inoculate a TSB broth with E. coli and incubate at 37C. How many bacterial cells are in the culture after 2 hours (generation time of 20 minutes in log phase)? Assume that the inoculum consisted of 1000 cells, and that cells were in log phase for the entire 2 hours.
Which of the following is TRUE of both Klinefelter syndrome and Turner syndrome? Both are the result of mitotic errors early in development. Both give rise to individuals who have external male genitalia. Both typically result from nondisjunction. It is the mechanism by which dizygotic, but not…
A 22-year-old presents with a sudden, severe headache accompanied by meningismus and vomiting. Emergent CT scan is negative. LP results reveal sample is positive for xanthochromia. What would be the most appropriate next step? O MRI scan with gadolinium O Admission and antibiotics O Hydration…
Food-borne intoxication is when... A You ingest live bacteria and they make you sick B You ingest endospores and they germinate in your stomach C You ingest the toxin that was produced by live bacteria in the food you ate before you ate it Last saved 9:15:33 PM Questions Filter (12)
23. Complete the following table: If necessary, you may put your answers below the table. Blood Group Antigens on red blood cells Antibodies in plasma Can receive blood from Can give blood to A A B Anti-A AB A and B O A and AB
What is a characteristic of the DNA that undergoes homologous recombina It is located on the ends of chromosomes. It is double stranded. It is located in the middle of chromosomes. It is nearly identical or completely identical in sequence. Need help on this question? Get a hint Show answer
Changes in environmental temperature may: Select one: a. Affect the fluidity of bacterial membranes b. Affect the motion of macromolecules within the bacterial cell c. Affect the stability of nucleotides and/or denature DNA within bacteria d. All of the above
1
...
4
5
6
7
8